ID: 1020214265

View in Genome Browser
Species Human (GRCh38)
Location 7:6177655-6177677
Sequence CCGGTTGCACTGGGCTCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 47}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020214259_1020214265 -2 Left 1020214259 7:6177634-6177656 CCCATGGACACGGGAGAGGAACC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47
1020214251_1020214265 25 Left 1020214251 7:6177607-6177629 CCCATAATACGGTAATGCCTCTC 0: 1
1: 0
2: 1
3: 2
4: 49
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47
1020214254_1020214265 8 Left 1020214254 7:6177624-6177646 CCTCTCTCCTCCCATGGACACGG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47
1020214252_1020214265 24 Left 1020214252 7:6177608-6177630 CCATAATACGGTAATGCCTCTCT 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47
1020214258_1020214265 1 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47
1020214260_1020214265 -3 Left 1020214260 7:6177635-6177657 CCATGGACACGGGAGAGGAACCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020214265 Original CRISPR CCGGTTGCACTGGGCTCGCT TGG Intronic