ID: 1020214267

View in Genome Browser
Species Human (GRCh38)
Location 7:6177667-6177689
Sequence GGCTCGCTTGGTATTGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020214254_1020214267 20 Left 1020214254 7:6177624-6177646 CCTCTCTCCTCCCATGGACACGG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG 0: 1
1: 0
2: 0
3: 3
4: 49
1020214258_1020214267 13 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG 0: 1
1: 0
2: 0
3: 3
4: 49
1020214259_1020214267 10 Left 1020214259 7:6177634-6177656 CCCATGGACACGGGAGAGGAACC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG 0: 1
1: 0
2: 0
3: 3
4: 49
1020214260_1020214267 9 Left 1020214260 7:6177635-6177657 CCATGGACACGGGAGAGGAACCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020214267 Original CRISPR GGCTCGCTTGGTATTGAGAC GGG Intronic
902334566 1:15747567-15747589 GGCTGGCTTGGTGTTGACACTGG - Exonic
909991487 1:82227877-82227899 GGCTGACTTGGAATTAAGACTGG - Intergenic
1063331979 10:5168762-5168784 GGCTCTCTTGTTATTGGGAATGG - Intergenic
1070330582 10:75414021-75414043 GGCTAGGTTGGTATTCAGCCAGG - Intergenic
1075345419 10:121678643-121678665 GGCTCTGTTGGTCTTGAGGCTGG - Intergenic
1089129490 11:116200688-116200710 GGTTCGCTTGGTGTTGTGTCTGG + Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1098787383 12:74776641-74776663 TGCTTGCTTGCTTTTGAGACAGG - Intergenic
1100181686 12:92093075-92093097 GGTTTGCTTGTTTTTGAGACAGG + Intronic
1104356529 12:128091481-128091503 GGCTTGCTTGTTATTGTGGCTGG - Intergenic
1106283847 13:28302052-28302074 GGTTTGGTTGGTATAGAGACGGG + Exonic
1107202052 13:37733265-37733287 GGCTCGCTGTGTTTTGGGACTGG - Intronic
1112073066 13:95876345-95876367 GGCTGGCCTGGCATTGAGGCTGG + Intronic
1112566420 13:100554751-100554773 GGCTCGATAGTTATTGAAACTGG + Intronic
1112583482 13:100696375-100696397 GGCTCACCTGATATTGAGGCAGG + Intergenic
1114278677 14:21170122-21170144 GGCTCACTTGGAAGAGAGACTGG - Intergenic
1121993575 14:98584440-98584462 GGCTCTCTTAGAGTTGAGACAGG - Intergenic
1124916475 15:33979477-33979499 TGCTTGCTTGTTTTTGAGACAGG - Intronic
1129169981 15:73801709-73801731 GGGTAGCTGGGTAGTGAGACAGG + Intergenic
1137527460 16:49248965-49248987 GACTCGGTTGGGATTGGGACTGG - Intergenic
1141500147 16:84438488-84438510 TGCTCTCTTGGAAATGAGACTGG - Intronic
1146467348 17:33096713-33096735 GGCTCGCTTGGTTGGGAGTCAGG + Intronic
1149756213 17:59188309-59188331 TGCTCTCTTGTTATTGAGAATGG + Intronic
1151826530 17:76527150-76527172 GGCGCCCTTGGTAGTGGGACAGG + Intergenic
1163466834 19:17472823-17472845 GGCTCCCTTTTTTTTGAGACAGG + Intronic
1164571787 19:29379993-29380015 GGTCCGCATGGAATTGAGACAGG + Intergenic
926731635 2:16039925-16039947 GGCGCCAGTGGTATTGAGACAGG - Intergenic
929076529 2:38083379-38083401 GGCTTGCTTGGTTTTAGGACAGG + Intronic
935053890 2:99548735-99548757 GGTTTGGTTGGTTTTGAGACCGG - Intronic
936665149 2:114586243-114586265 TGCTTGCTTGTTTTTGAGACAGG - Intronic
1173769271 20:45644345-45644367 GGCTTGCTTGTTTTTGAGACAGG + Intergenic
1175001220 20:55632662-55632684 GGCAGGCATGGGATTGAGACCGG - Intergenic
950874647 3:16260259-16260281 GACTGGCTTGGTATAGAAACTGG + Exonic
953514673 3:43578366-43578388 GGGTCGCTGGGGACTGAGACTGG - Intronic
953814227 3:46141198-46141220 GGTTTGGTTGGTATAGAGACAGG + Intergenic
959128875 3:102326359-102326381 GGCTGGCTTGCTATAGAGAGTGG + Intronic
960327695 3:116317319-116317341 GGCTCTCTTTGTATTGTGTCCGG - Intronic
968067533 3:195767000-195767022 GGTCCGCTTGGTCATGAGACAGG + Intronic
1008084602 6:47231032-47231054 GGCTCTCATGGTCTTGAGGCAGG - Intergenic
1015375727 6:132508180-132508202 TGCTTGCATGGTTTTGAGACAGG - Intronic
1018023724 6:159788520-159788542 GGCTCGCTTTGTTTAGGGACAGG - Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1020228378 7:6298036-6298058 TGTTTGTTTGGTATTGAGACAGG - Intergenic
1024703974 7:51938014-51938036 GGCTAGCTTGGCATTGGTACTGG + Intergenic
1025306434 7:57863799-57863821 GGCTCGATTTCTATTGAGACTGG + Intergenic
1033632819 7:143177238-143177260 GTCTTGCTTGGTATTCAGAAGGG - Intergenic
1040892653 8:52333780-52333802 GGCTCTCTTGCTACTGAAACTGG + Intronic
1053147817 9:35723864-35723886 GGCAGGCTTGGAATGGAGACAGG + Intronic
1053249107 9:36559779-36559801 TGTTCGCTTGTTTTTGAGACAGG + Intergenic
1193598538 X:83478931-83478953 TGCTTGCTTGTTTTTGAGACAGG - Intergenic
1194324149 X:92490663-92490685 GGCACGCATGATAGTGAGACAGG - Intronic
1200632253 Y:5603768-5603790 GGCACGCATGATAGTGAGACAGG - Intronic