ID: 1020217635

View in Genome Browser
Species Human (GRCh38)
Location 7:6206814-6206836
Sequence AGCCACAGGATATAAGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020217635_1020217640 28 Left 1020217635 7:6206814-6206836 CCTCTACCTTATATCCTGTGGCT 0: 1
1: 0
2: 1
3: 5
4: 143
Right 1020217640 7:6206865-6206887 AAATCCCAGCAGCGTTTTAAGGG 0: 1
1: 0
2: 1
3: 10
4: 147
1020217635_1020217638 3 Left 1020217635 7:6206814-6206836 CCTCTACCTTATATCCTGTGGCT 0: 1
1: 0
2: 1
3: 5
4: 143
Right 1020217638 7:6206840-6206862 AGATACAAAGCATCAAGTAAAGG No data
1020217635_1020217639 27 Left 1020217635 7:6206814-6206836 CCTCTACCTTATATCCTGTGGCT 0: 1
1: 0
2: 1
3: 5
4: 143
Right 1020217639 7:6206864-6206886 CAAATCCCAGCAGCGTTTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020217635 Original CRISPR AGCCACAGGATATAAGGTAG AGG (reversed) Intronic
903627507 1:24742190-24742212 AGCCAAAGGAAGTAAGGGAGTGG + Intergenic
903873049 1:26451037-26451059 AGAAGCAGGAGATAAGGTAGTGG - Intronic
905318497 1:37098701-37098723 AGCCACAGGAAAACAGGTTGTGG - Intergenic
906334860 1:44920146-44920168 AGACACAGGATATAAGAAAAAGG - Intronic
907405715 1:54252324-54252346 AGCGATAGGATTTTAGGTAGTGG - Intronic
907532935 1:55120054-55120076 AGTCCCAGGATAGGAGGTAGGGG - Intronic
908715147 1:67061938-67061960 AACCACAGAAGACAAGGTAGGGG - Intergenic
909120992 1:71602776-71602798 AGTCACAGGATATAAACTGGAGG + Intronic
909486489 1:76179817-76179839 AGCCAGAGGAAATGAGGGAGGGG - Intronic
910379317 1:86609091-86609113 AGCCACAGCAGATAAGGCACTGG - Intergenic
910440174 1:87243622-87243644 CCCCACAGGACATAAGGTATGGG + Intergenic
911740726 1:101384341-101384363 AAACAAAGAATATAAGGTAGAGG - Intergenic
914431390 1:147622921-147622943 AGCCACAGGATTTCAGACAGTGG + Intronic
914951088 1:152115021-152115043 AGTCACAGCATTTAAGGTACTGG - Intronic
915758979 1:158291815-158291837 AGCCACATAATATAGGATAGAGG - Intronic
920200646 1:204257845-204257867 AGACACAGGATAGAACCTAGAGG + Exonic
920355535 1:205369314-205369336 TGCCAAAGGGTATAAGGGAGTGG + Intergenic
923765965 1:236892691-236892713 CGCCACAGAATATAAGGCACTGG + Intronic
1064286364 10:13994981-13995003 AGCCACAGGAGTTAAGATAAAGG + Intronic
1074151371 10:110762672-110762694 AGCCACAGGAAAGAAGGATGAGG - Intronic
1074661731 10:115666931-115666953 TGCCATAGGATCTAAGGGAGGGG + Intronic
1076147094 10:128131346-128131368 GGCCACAGCAAATAAGGTGGCGG - Intergenic
1076365569 10:129919378-129919400 AGCCACAGGGAATAAGGCTGGGG + Intronic
1076774985 10:132690232-132690254 AGGCACAGGATGTCAGGCAGAGG - Intronic
1077819145 11:5718768-5718790 AGATACAGGATATGAGGGAGTGG - Intronic
1078197068 11:9144964-9144986 ACCCTCAGGCTGTAAGGTAGAGG - Intronic
1078597744 11:12703047-12703069 AGCCCCAGGATAAGATGTAGTGG - Intronic
1079787247 11:24689026-24689048 AGCCAAGGGGTATAAGGCAGAGG + Intronic
1080246985 11:30190282-30190304 ACCCACTGGATAGAAGGTTGGGG - Intergenic
1084291137 11:68168806-68168828 AGCCAGAGGGTAAAAGGAAGAGG - Intronic
1087006660 11:93478373-93478395 AGCCACAGGAGAAAGGGAAGGGG + Intergenic
1088737255 11:112737900-112737922 AGTCACAGGATACAGTGTAGGGG + Intergenic
1089622716 11:119730768-119730790 AGAGACTGGATTTAAGGTAGAGG + Intergenic
1090286258 11:125502043-125502065 AGCCACAGGGTAGATTGTAGTGG + Intergenic
1092023391 12:5221342-5221364 AGCAACAGGATTTAAGGGGGTGG - Intergenic
1094141158 12:27183094-27183116 AGCAACTGGTTATAAAGTAGGGG - Intergenic
1097702997 12:62839226-62839248 AGCCAGAAGATCTAAGGTTGTGG - Intronic
1100818231 12:98406447-98406469 AGCTAGAGGATACAAGGCAGTGG - Intergenic
1101660917 12:106764908-106764930 AGCCACAGGAGAGAAGGCACTGG + Intronic
1102165522 12:110803497-110803519 AGCAAGAGGATATAAGATACAGG - Intergenic
1103671232 12:122617567-122617589 GGCCACAGGAAAGAAGGAAGGGG - Intronic
1108024845 13:46167126-46167148 TGCCACAGGGTGGAAGGTAGGGG + Intronic
1109757522 13:66779975-66779997 GGTCAAAGGATATAAAGTAGAGG + Intronic
1110719131 13:78741816-78741838 AGGCACAGGAACCAAGGTAGAGG - Intergenic
1116652820 14:47615615-47615637 AGACAGAGGATAGAAGGAAGAGG + Intronic
1116809097 14:49522284-49522306 ATCCACAGGGTAGAAGGTAGGGG + Intergenic
1116851759 14:49915938-49915960 AGCCCTAAGATATAAGGAAGAGG + Intergenic
1119887370 14:78154176-78154198 AGCCCCAGGATCTAATGTTGGGG + Intergenic
1122314607 14:100818301-100818323 AGCCACAGGAAAGACGGCAGGGG + Intergenic
1124321474 15:28715309-28715331 TGCAACAGGAGATAAGATAGAGG + Intronic
1124522568 15:30417126-30417148 TGCAACAGGAGATAAGATAGAGG + Intergenic
1124536096 15:30549088-30549110 TGCAACAGGAGATAAGATAGAGG - Intergenic
1126208618 15:46074880-46074902 AGACACAGAATAAAAGGGAGAGG - Intergenic
1128893487 15:71351917-71351939 AGCCAAATGACAGAAGGTAGTGG - Intronic
1130457343 15:84125139-84125161 AGCAACAAAATATAAGATAGTGG - Intergenic
1132063642 15:98712939-98712961 TGCTACAGGATTTCAGGTAGGGG - Intronic
1133149432 16:3816538-3816560 AGCCACAGGATTTAATGGATGGG - Intronic
1133695136 16:8256053-8256075 AGCAATAGGATATATGGAAGAGG + Intergenic
1137433184 16:48434756-48434778 ACCCACAGGGTAAAAGGAAGAGG - Intronic
1137840615 16:51637379-51637401 ATCCACAGGAAATTAGGTTGAGG - Intergenic
1141445712 16:84056565-84056587 AACCACTGCATATAAGGAAGTGG + Intronic
1142799988 17:2338608-2338630 AGGCACTGGATACAAGGCAGTGG - Intronic
1144677441 17:17171032-17171054 AGACACAGGCTAGAAGGAAGGGG + Intronic
1146806762 17:35871160-35871182 ATCCACTGGGGATAAGGTAGAGG + Intergenic
1148853493 17:50566075-50566097 ACCCACAGGTTATCAGGTTGGGG - Intronic
1149449162 17:56736407-56736429 GGCCACAGGAAACCAGGTAGAGG + Intergenic
1151092589 17:71459881-71459903 AGACACAGGAATTAAGGGAGAGG + Intergenic
1151450231 17:74194250-74194272 AGCCACAGGCTACAGGGAAGGGG + Intergenic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1159959151 18:74541881-74541903 CGCCACAGGACATAAAGTTGGGG + Intronic
1162359212 19:10207473-10207495 AACCACAGGATATAATGCATGGG + Intronic
1162968940 19:14168625-14168647 AGCCGCAGGAAAGAAGCTAGGGG - Intronic
1163035767 19:14567951-14567973 AGCCACAGGAAAGAAGGAAGCGG - Intronic
1164410498 19:28000831-28000853 AGTCACATGAAATGAGGTAGAGG + Intergenic
925227636 2:2199505-2199527 AGCCACAGGAGAAAAGGGTGAGG + Intronic
929061411 2:37928418-37928440 AATCACAGGATATAAAGCAGAGG + Intronic
929750908 2:44712580-44712602 AGCTACAGGATATATGTTTGTGG - Intronic
932049190 2:68381927-68381949 AGCCACAGGCTACATGGAAGGGG + Intronic
933732162 2:85465202-85465224 AGCCACTGGGTGGAAGGTAGAGG - Intergenic
934768555 2:96894183-96894205 GGCCACAGTTCATAAGGTAGAGG - Intronic
943674097 2:190699477-190699499 AGCCACAGAATAGAGGGTATTGG + Intergenic
944293382 2:198033832-198033854 AGCCAAAGAATATAAAGAAGAGG - Intronic
947403780 2:229753930-229753952 AGCCACAGAATATAAAGTAGTGG - Intergenic
948833035 2:240608267-240608289 AGCCAGAGGAAATAAGGCAAGGG - Intronic
1170478961 20:16745991-16746013 AGACACAGGACAGAAGCTAGAGG - Intergenic
1174512139 20:51061414-51061436 AGACACAGCATAGAAGGTATAGG - Intergenic
1177741449 21:25158809-25158831 AGCCACTGCATATAGGCTAGAGG + Intergenic
1179842831 21:44088391-44088413 AGCCACAGGATATCAGCTCATGG + Intronic
1181735403 22:24877580-24877602 AGCCATAGGATATAAGGGGTGGG + Intronic
951006627 3:17623341-17623363 AGCCATTGGATATGAGTTAGGGG - Intronic
955530166 3:59864605-59864627 GGCCACAGGATATAGGGCTGCGG - Intronic
958870805 3:99556584-99556606 ACTAAAAGGATATAAGGTAGGGG - Intergenic
964426436 3:156559144-156559166 AGGCATAGGACATGAGGTAGTGG + Intergenic
964997639 3:162905550-162905572 AAACATAGGTTATAAGGTAGGGG - Intergenic
966922640 3:184623671-184623693 AGGCACAGGATCTAAGTTACAGG - Intronic
967048965 3:185764554-185764576 AGCAACAGGTTATCAGGAAGGGG + Intronic
967996726 3:195172586-195172608 AGCCACTGCAGATAAGGCAGGGG + Intronic
971369158 4:26001919-26001941 GGCCACAGGGTGAAAGGTAGAGG - Intergenic
975476758 4:74832522-74832544 GACCACTGGATAGAAGGTAGTGG - Intergenic
976272754 4:83247660-83247682 AGCCACAGTGTGTAAGGTGGCGG - Intergenic
978227675 4:106357215-106357237 AACCACAGGTTACAAGGAAGTGG + Intergenic
978881354 4:113707005-113707027 AGACACAGCATACAAGGTAAAGG + Intronic
978907657 4:114026867-114026889 AGCCACAGGAGAAAAGTGAGTGG - Intergenic
980621144 4:135306044-135306066 TGCTACAGAATATAAGGTACCGG + Intergenic
981121746 4:141059081-141059103 AACCACAGGATACAGGATAGGGG - Intronic
981180938 4:141743261-141743283 ATCATCAGGAGATAAGGTAGTGG - Intergenic
982506667 4:156227214-156227236 ATCCACAGGTCATAAGTTAGAGG - Intergenic
982973654 4:162023829-162023851 AGCCAGAGGCCAGAAGGTAGGGG - Intronic
983220493 4:165039448-165039470 AGCCACAGGTTATAATACAGCGG - Intronic
988095350 5:26601021-26601043 AGCCACAGAATATATGCAAGAGG - Intergenic
988141260 5:27244025-27244047 AGTAACAAAATATAAGGTAGTGG + Intergenic
990037514 5:51339733-51339755 AGCCAGAGGAAATAAACTAGAGG + Intergenic
990808768 5:59698183-59698205 AGCCACAGGATATTAAGCAGAGG + Intronic
991354838 5:65757453-65757475 AACCACAGTATATAACTTAGAGG + Intronic
993428344 5:87798998-87799020 AGGCAAAAGATAAAAGGTAGAGG + Intergenic
998876018 5:146600124-146600146 TGCCACAGGATTTAAGATAACGG - Intronic
1003125912 6:3355859-3355881 AGCCACTGGATATAACGCTGAGG + Intronic
1009549564 6:65070379-65070401 AGTGACAAGACATAAGGTAGAGG - Intronic
1011722191 6:90168837-90168859 TGGAACAGGAAATAAGGTAGTGG - Intronic
1014375114 6:120662372-120662394 AGCCACAGGATGGAAGATAGTGG + Intergenic
1014383504 6:120773648-120773670 AGGAAAAGGATATAAGTTAGTGG - Intergenic
1014892235 6:126856736-126856758 AGCTACAGGATAAAAGCGAGAGG + Intergenic
1016011147 6:139138164-139138186 AGCTATAGTTTATAAGGTAGGGG + Intronic
1020217635 7:6206814-6206836 AGCCACAGGATATAAGGTAGAGG - Intronic
1024013913 7:45294181-45294203 AGCCACAGTAGATCAGGGAGTGG + Intergenic
1025969578 7:66309629-66309651 GGCCACTGGATATAAGGCACAGG + Intronic
1028041597 7:86060574-86060596 GCCCTCAGGATAAAAGGTAGAGG + Intergenic
1028077818 7:86536318-86536340 AGCCAAGGGGCATAAGGTAGAGG + Intergenic
1028334899 7:89639731-89639753 AGCCAGAGGATATTTGGTAATGG + Intergenic
1029130116 7:98323518-98323540 ATCCACATTATATAAGGTTGTGG - Intronic
1030960417 7:115913477-115913499 AGACACAGAATCTAAGGTAGAGG - Intergenic
1032462541 7:132122587-132122609 AGCCTCAGGTCATCAGGTAGAGG - Intergenic
1034099083 7:148436256-148436278 TGCGACAGGATATGTGGTAGAGG - Intergenic
1034479875 7:151311386-151311408 AGCCACAGGAGAAAATGCAGGGG + Intergenic
1035610629 8:961216-961238 AGCCACATGATAGAAGTCAGTGG - Intergenic
1037149533 8:15619033-15619055 AAACACAGCATATAAGGTAATGG - Intronic
1038308941 8:26430632-26430654 AGCATCAGGAACTAAGGTAGAGG - Intronic
1040018620 8:42720578-42720600 AGCCCCAGGATAAGAGGTTGAGG + Intronic
1042427617 8:68666589-68666611 AGCCACACAACATAAGGAAGTGG + Intronic
1043133450 8:76490631-76490653 AGCAAAAGGATATAAGGTTAGGG + Intergenic
1045189947 8:99872319-99872341 AGCCACAGAATACAAAGCAGTGG - Intronic
1049293136 8:141814430-141814452 AGACACAGGAGTTAAGGGAGCGG - Intergenic
1049393355 8:142383168-142383190 GGCCACAGGACCTAAGGGAGGGG + Intronic
1051775873 9:20633562-20633584 AGACAAAGGATATGAGGTGGTGG + Intergenic
1054747501 9:68869467-68869489 ACCCACATGATATAAGACAGTGG - Intronic
1056934616 9:90906518-90906540 AGCAACAGGCTGTGAGGTAGGGG - Intergenic
1058188699 9:101887185-101887207 AACCATATGATTTAAGGTAGAGG - Intergenic
1059861643 9:118470106-118470128 AGCCACACAATATTAGTTAGTGG + Intergenic
1189194630 X:39142449-39142471 AGCCAAAAGATAGAATGTAGTGG + Intergenic
1195163698 X:102196858-102196880 AGGCACAGGATATAATGTCCTGG + Intergenic