ID: 1020222968

View in Genome Browser
Species Human (GRCh38)
Location 7:6255601-6255623
Sequence TCCCTATCTTGATGAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020222968_1020222975 -6 Left 1020222968 7:6255601-6255623 CCAGCACCTCATCAAGATAGGGA 0: 1
1: 1
2: 0
3: 10
4: 123
Right 1020222975 7:6255618-6255640 TAGGGAGGGAGGGATATGTTGGG No data
1020222968_1020222974 -7 Left 1020222968 7:6255601-6255623 CCAGCACCTCATCAAGATAGGGA 0: 1
1: 1
2: 0
3: 10
4: 123
Right 1020222974 7:6255617-6255639 ATAGGGAGGGAGGGATATGTTGG 0: 1
1: 0
2: 4
3: 60
4: 636
1020222968_1020222976 -5 Left 1020222968 7:6255601-6255623 CCAGCACCTCATCAAGATAGGGA 0: 1
1: 1
2: 0
3: 10
4: 123
Right 1020222976 7:6255619-6255641 AGGGAGGGAGGGATATGTTGGGG No data
1020222968_1020222977 3 Left 1020222968 7:6255601-6255623 CCAGCACCTCATCAAGATAGGGA 0: 1
1: 1
2: 0
3: 10
4: 123
Right 1020222977 7:6255627-6255649 AGGGATATGTTGGGGACATCAGG 0: 1
1: 0
2: 0
3: 23
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020222968 Original CRISPR TCCCTATCTTGATGAGGTGC TGG (reversed) Intronic
900695044 1:4004548-4004570 TCCCTATCGTGATTAGCAGCTGG - Intergenic
900781190 1:4618050-4618072 TCCTTATCTTGAGTGGGTGCTGG + Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
906051625 1:42879385-42879407 TCATTATCTTGATGTGGTGATGG - Intergenic
906166264 1:43688718-43688740 TCAGTATCTTGATGATGTGTAGG - Intronic
908368649 1:63456689-63456711 ACCCTATCTTAATGAGCTGATGG + Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912985692 1:114427620-114427642 TCTGTATCTTGATGTGGTGGTGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
921792163 1:219302449-219302471 TCCTTATGTTGGTGAGGTGTAGG + Intergenic
924920313 1:248622018-248622040 TCCGTTTCTTGATGGGGTGCGGG + Intergenic
1062816527 10:505216-505238 ACTCTGTGTTGATGAGGTGCCGG - Intronic
1063447511 10:6128614-6128636 TGCATATCCAGATGAGGTGCAGG - Intergenic
1065506327 10:26433560-26433582 TCCCCATCTTGATGATGGGATGG + Intergenic
1067691838 10:48507016-48507038 ACCCTATCTTGCTGGGGTACTGG - Intronic
1069792115 10:71029557-71029579 TCCCCAACTGGCTGAGGTGCTGG - Intergenic
1070506766 10:77120280-77120302 TCCCTTTCCTGATGACCTGCCGG - Intronic
1073674031 10:105624835-105624857 TCTGTATCTTGATTAGGTGGTGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1085407332 11:76271109-76271131 TACCTATCTCGAAGAGCTGCCGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1088939379 11:114438343-114438365 ACCCTATCTTGAATAGGGGCTGG + Intronic
1091684102 12:2549445-2549467 TTGCTACCTTGATGAGCTGCTGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1101938850 12:109083859-109083881 TCCCTGACATGATGAGGTGTCGG - Intronic
1102535831 12:113580252-113580274 TACCTACCTTGCTGAGTTGCTGG - Intergenic
1104848999 12:131862245-131862267 TCGATAACTTGGTGAGGTGCAGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108334974 13:49431098-49431120 TCACTATCTTGATGTGATGATGG - Intronic
1112132915 13:96543284-96543306 TCCCTGTCATCATGTGGTGCAGG + Intronic
1112720205 13:102235769-102235791 ACTCTATCTTGAATAGGTGCTGG + Intronic
1113059346 13:106304964-106304986 TCTATATCTTGATCAGGTGTAGG + Intergenic
1118052073 14:62040246-62040268 TCCATATCTTCATGAGGTTTGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122525161 14:102376904-102376926 TCCTCATCTGGTTGAGGTGCCGG - Exonic
1129055206 15:72814427-72814449 TTCCTACCTTGATGACATGCAGG - Intergenic
1132054990 15:98644397-98644419 TCTATATCTTGATGGGGTGTTGG - Intergenic
1132610340 16:812925-812947 TCCCTCACTTGATCAGGTGCGGG + Intronic
1133042623 16:3068618-3068640 GCCCTGTCTTGATGTGGTGTGGG + Intronic
1136623103 16:31442996-31443018 TCCCTGTCTTGGTGAGGGCCAGG - Exonic
1141499021 16:84430908-84430930 TCCCCATCCTGCTGAGGTGGGGG - Intronic
1142317082 16:89354505-89354527 TCCCTATCAAGAGCAGGTGCTGG - Intronic
1144352280 17:14408632-14408654 TCCCCATCTTGTTGAGGTCTTGG + Intergenic
1144486200 17:15666499-15666521 TCTCTATCTTGATTGGGTGGTGG - Intronic
1144914819 17:18715793-18715815 TCTCTATCTTGATTGGGTGGTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146387349 17:32389070-32389092 TCCCTCTCTTGAGGGGGAGCTGG - Intergenic
1149151116 17:53565085-53565107 TCCCCATCTTCATGAGTTGAGGG - Intergenic
1151744075 17:76002127-76002149 TCCCTACCTTGATGAGGTGCAGG - Exonic
1152411971 17:80130544-80130566 TTTCTATCTTGAAAAGGTGCTGG + Intergenic
1154371028 18:13763400-13763422 TCAATATCGTGGTGAGGTGCAGG - Exonic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164700661 19:30281744-30281766 CCCTTATTTTGATGAGGTGGGGG + Intronic
1165373611 19:35425974-35425996 TCCCTCTCTTGAGCAGGAGCAGG + Intergenic
1168018638 19:53593409-53593431 TGCCAATCTAGATGAGGAGCCGG - Intergenic
929583596 2:43100392-43100414 TCTATATCTTGATGAGATGTGGG + Intergenic
930023950 2:47018780-47018802 TCTCTCCCTGGATGAGGTGCTGG - Intronic
930187288 2:48422546-48422568 TCACTATCTTGATGAGGGTGTGG - Intergenic
932891132 2:75598213-75598235 ACCAAATCTTGATGTGGTGCTGG - Intergenic
933682558 2:85114956-85114978 TCCCTATATTGATTAGTTGTTGG - Intergenic
933857946 2:86435910-86435932 TCTATATCTTGATGGGGTGTAGG + Intergenic
941403027 2:165055194-165055216 ACACTATCTTGATGAAATGCGGG + Intergenic
941672681 2:168311350-168311372 TCCCATCCTTGATCAGGTGCTGG + Intergenic
947177160 2:227379450-227379472 TCCATATTATGATGAGGTGAAGG + Intronic
947761092 2:232604468-232604490 TCCCCATCTTGCTGAGCTGTGGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1169889625 20:10438326-10438348 TCATTATCTTGATGAGGTGATGG - Intronic
1170744898 20:19090630-19090652 TCCCTCTTTTGAAGAGGGGCAGG - Intergenic
1170967923 20:21092680-21092702 TCCCGATCTTTAGGAGTTGCAGG + Intergenic
1171994313 20:31720447-31720469 TCCCTACCTAGCGGAGGTGCAGG - Intronic
1172323084 20:34012240-34012262 GCCCTATCATCATGAGGTGGCGG + Intronic
1173220726 20:41130799-41130821 TCTCTATCTTGATTGGGTGGAGG + Intergenic
1174713689 20:52734062-52734084 TCTGTATCTTGATTAGGTGCTGG - Intergenic
1177363198 21:20100699-20100721 TCATTATCTTGATGTGGTGATGG - Intergenic
1178242427 21:30918072-30918094 TCCCTCTCTTGATGAGGTAATGG - Intergenic
1183106603 22:35619487-35619509 CCCCAATCTTGCTGAGGTGCAGG + Intronic
1185189324 22:49424382-49424404 TCCCTGTCTTGGGGAGGGGCTGG - Intronic
950740449 3:15046894-15046916 ACCCTGTCTTGATGAGGGGTTGG - Exonic
953253931 3:41271144-41271166 TCACTGTCTTGATGTGGTGTTGG - Intronic
953608632 3:44428994-44429016 CCCCTGTCTGGATGTGGTGCTGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
961607417 3:128106938-128106960 TCCCTTTTTTGATTAGCTGCTGG + Intronic
963676770 3:148322089-148322111 TCACTATCCTGGTGAGATGCAGG + Intergenic
969868006 4:10087700-10087722 GCCTTACCTTGATGACGTGCAGG + Exonic
971446834 4:26759552-26759574 TCTATATCTTGATGTGGTGGTGG - Intergenic
972934486 4:44115858-44115880 TCGCTATTTTGATGATGTTCAGG + Intergenic
976756713 4:88506432-88506454 TCCCTACCTTGAAGAGAGGCTGG - Intergenic
982189206 4:152836115-152836137 ACCATATGTTGAAGAGGTGCGGG + Intronic
985891039 5:2715372-2715394 TCCTTCTCTTGGGGAGGTGCAGG - Intergenic
989037090 5:37186346-37186368 TCCCTATCCTGAGGACGTGAGGG - Exonic
992662093 5:78971792-78971814 TCACTATCTTGATGTGGTGATGG + Intronic
993669442 5:90742551-90742573 TGCCTTTCTTGAGGAGGTGATGG + Intronic
994457242 5:100026715-100026737 TACTTTTCTTGATGATGTGCTGG - Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005509510 6:26499945-26499967 TACCTTTCTTGAAGAGGTGTTGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007706598 6:43795118-43795140 TCCTTCTCGTAATGAGGTGCAGG + Intergenic
1009431313 6:63569644-63569666 TGCCTATCGTGATGAGGTTAAGG + Intronic
1009855080 6:69251993-69252015 TCCATATCTTGATCAGGTATTGG - Intronic
1014548090 6:122755788-122755810 TCCCAATTTCTATGAGGTGCTGG + Intergenic
1019810195 7:3159501-3159523 ACTCTATCTTGAAGAGGAGCTGG - Intronic
1020222968 7:6255601-6255623 TCCCTATCTTGATGAGGTGCTGG - Intronic
1024922143 7:54569426-54569448 TCCCTATCCTGATGACATTCAGG - Exonic
1030922879 7:115414529-115414551 TTCATATCTTGATGTGGTGGTGG + Intergenic
1031284623 7:119849693-119849715 TCCCTATTTTGATGAGTTTGTGG - Intergenic
1032596015 7:133241323-133241345 TCTCTTTCTTGATTAGGTGCTGG - Intergenic
1035328903 7:158083919-158083941 TCCCTAACTTGAATATGTGCAGG + Intronic
1037912395 8:22751438-22751460 TCCCTATCTTGATGAACTAAGGG + Intronic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1042861168 8:73315559-73315581 CACCTACCTTGATGTGGTGCTGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1047064039 8:121260675-121260697 TTCCTTTCTGGAAGAGGTGCTGG - Intergenic
1047567893 8:126066169-126066191 TCCCTATCTGGGTGTGCTGCAGG + Intergenic
1048139320 8:131777691-131777713 TACATATCTTCTTGAGGTGCAGG + Intergenic
1051030390 9:12667551-12667573 ACCCTATCTTGAATAGGAGCTGG - Intergenic
1053534055 9:38908255-38908277 TCCCTGTTTTCATGAGCTGCAGG - Intergenic
1054206279 9:62132674-62132696 TCCCTGTTTTCATGAGCTGCAGG - Intergenic
1054632078 9:67455672-67455694 TCCCTGTTTTCATGAGCTGCAGG + Intergenic
1062532916 9:137009566-137009588 GCCCTGTCTTGATGAGGTCAAGG + Exonic
1185890962 X:3821677-3821699 TCTCTATCTTCATGAGATCCAGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195065623 X:101235881-101235903 GCACCATCTTGAGGAGGTGCAGG - Exonic
1198827242 X:140712617-140712639 TCCCTATCTAGAAGAGGTAGTGG - Intergenic
1199672962 X:150161979-150162001 TCCCTAGCTTGATAAGGTCTTGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic