ID: 1020223658

View in Genome Browser
Species Human (GRCh38)
Location 7:6262080-6262102
Sequence CAGCAATTACAGCTGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020223658 Original CRISPR CAGCAATTACAGCTGAAGAA AGG Intronic
900037679 1:431111-431133 CAGCAATGACACCTGCAGACTGG - Intergenic
900059309 1:666854-666876 CAGCAATGACACCTGCAGACTGG - Intergenic
901408672 1:9067460-9067482 CACCAAGTCCAGCTGCAGAAAGG - Intronic
901654769 1:10762974-10762996 CAGCAAGAACAACTGAATAAAGG + Intronic
901659100 1:10787566-10787588 CAGCAATTAGTGCTGGGGAAGGG + Intronic
905359081 1:37406103-37406125 CAGACATTTTAGCTGAAGAATGG + Intergenic
905984300 1:42264088-42264110 CAACAAATTCAGCTGAAGTATGG + Intronic
906211183 1:44013121-44013143 CAGCAGTTACAGCTGTAAAAGGG + Intronic
906245047 1:44267548-44267570 CAGCAATCACAGCGCAATAAAGG + Intronic
908822472 1:68102604-68102626 CAGCAAATACAGATGAATATAGG - Intronic
910130587 1:83900528-83900550 CAGCAAGGACAGCCGAAGCAAGG + Intronic
911100370 1:94091022-94091044 CAGGAATTCCAGGTGGAGAAAGG + Intronic
911434021 1:97831688-97831710 CAACCATCACAGCAGAAGAAAGG + Intronic
911537578 1:99118995-99119017 CAGCAATTAAAGTTCAAGGATGG - Intergenic
911642148 1:100300980-100301002 CAGCAATCAAAGTTGCAGAATGG + Intergenic
912231084 1:107793538-107793560 CAGTAACTACATCTGAACAAGGG + Intronic
912922158 1:113879605-113879627 CAGCAAACACAGCTGTAGATAGG - Intronic
918394515 1:184100053-184100075 AAGCAATTACAAATGAAGCAGGG - Intergenic
919121370 1:193344911-193344933 CAGTAGTTGCAGCTGAAAAATGG + Intergenic
919772242 1:201169955-201169977 CAGGAGTCACAGCTGAAGATTGG - Intronic
920818095 1:209354426-209354448 GAGCAATTCCACCTTAAGAAGGG - Intergenic
921793007 1:219311276-219311298 CAGCAATATCACCTGAAAAATGG + Intergenic
1062947300 10:1471333-1471355 CACCAAATAAAACTGAAGAAGGG - Intronic
1065289252 10:24213832-24213854 CAGAAATTACAGCTGAAACCAGG - Intronic
1067017451 10:42768793-42768815 CAGCAACAACAGCAGCAGAAAGG - Intergenic
1067267948 10:44763422-44763444 CACCTCTTACAGGTGAAGAAGGG + Intergenic
1070239988 10:74670160-74670182 CTGCAATTAGAGCCAAAGAAAGG - Intronic
1071174162 10:82904448-82904470 CAGCATTTAAACCGGAAGAAAGG + Intronic
1073605803 10:104894672-104894694 CAGCAATTAGAGGTGAGGGATGG + Intronic
1074919852 10:117996627-117996649 CTGCAATTCCAAGTGAAGAATGG + Intergenic
1074959278 10:118425504-118425526 AAGCAATTAAAGGTGAAGAATGG + Intergenic
1076212558 10:128660174-128660196 TAGCAATTTCAGCTGAAGGAAGG + Intergenic
1076217632 10:128709391-128709413 CAGCAATTATAGCTGCGAAATGG - Intergenic
1076964406 11:69034-69056 CAGCAATGACACCTGCAGACTGG - Intergenic
1079760785 11:24327814-24327836 CATAAATTACAGATTAAGAATGG - Intergenic
1080505624 11:32910205-32910227 CAGCAATGCCTCCTGAAGAAGGG - Intronic
1081848510 11:46258706-46258728 GAGTAATTACAGCAGAAGACTGG + Intergenic
1084394401 11:68899261-68899283 CAGCAATAAAAGCTTAAAAACGG - Intronic
1085462960 11:76706350-76706372 CATGAATTCCACCTGAAGAAGGG - Intergenic
1086575365 11:88333841-88333863 CAGCAAATCCAGTTGAGGAAAGG + Intronic
1088161392 11:106875719-106875741 CATCAATTAGAGTTGGAGAAGGG + Intronic
1088278109 11:108110482-108110504 CAGTAATTACAGCATAATAAAGG - Intergenic
1088933088 11:114371966-114371988 CAGGAATTACTGCTGAGGATAGG - Intergenic
1089008430 11:115112875-115112897 CAGCTGTTAGAGCTGAGGAAGGG - Intergenic
1090675211 11:128986053-128986075 CAGCAGCAACAGATGAAGAAAGG - Exonic
1090803515 11:130188858-130188880 CAGCAGCTTCAGCTGAGGAAGGG - Exonic
1091076420 11:132622303-132622325 CAACAAAGACAACTGAAGAAAGG + Intronic
1093727911 12:22536707-22536729 CAGCAATTATCTCTGAAGAAGGG + Intronic
1094047840 12:26186871-26186893 AAACAATTACAGCTGAAGCAAGG - Intronic
1096048064 12:48581747-48581769 CAGCAATTACAACCTGAGAAGGG + Intergenic
1096394021 12:51252015-51252037 CAGAAAGTGCAGATGAAGAAAGG + Intronic
1099034886 12:77573881-77573903 AAGGAATTAAAGTTGAAGAATGG + Intergenic
1099448267 12:82777769-82777791 CAAAAATTTCAGCTGAGGAATGG - Intronic
1101262258 12:103045218-103045240 AAATAAATACAGCTGAAGAACGG - Intergenic
1101707842 12:107237172-107237194 AAGGAGTTAAAGCTGAAGAATGG - Intergenic
1103327630 12:120131927-120131949 CAGCAAGCACTGCTGTAGAACGG + Exonic
1106135198 13:26968400-26968422 CAGTAATTAAAGTTGGAGAAGGG - Intergenic
1108827238 13:54428246-54428268 CAGCAAATACCATTGAAGAAGGG - Intergenic
1108873887 13:55020773-55020795 AAACAATAAAAGCTGAAGAAAGG - Intergenic
1109501043 13:63236340-63236362 ATGGAATGACAGCTGAAGAAAGG + Intergenic
1109622950 13:64932904-64932926 CGCAAATCACAGCTGAAGAAGGG - Intergenic
1114617077 14:24074075-24074097 AAGCCATTATTGCTGAAGAATGG + Exonic
1115300246 14:31877256-31877278 CAGCAAAAAGTGCTGAAGAAAGG - Intergenic
1116878483 14:50139296-50139318 CAGCAATTACGCATGAAAAAGGG - Intronic
1117993419 14:61457128-61457150 CAGAAATTGCAGCAGAAGCATGG - Intronic
1119566508 14:75633618-75633640 CAGCATTCAGACCTGAAGAAGGG - Exonic
1120107809 14:80516373-80516395 CCCCAACTAAAGCTGAAGAAAGG + Intronic
1124688719 15:31804167-31804189 GTGCAATTTCAGTTGAAGAAAGG - Intronic
1125316672 15:38440112-38440134 CAGAAATGACAGATAAAGAATGG - Intergenic
1125502415 15:40247927-40247949 CAGCCCTCACAGCTGCAGAAGGG - Intronic
1127858417 15:62972286-62972308 AGGCAATGAAAGCTGAAGAAAGG - Intergenic
1127999810 15:64180160-64180182 CCGAAATCACAGCTAAAGAAGGG + Intronic
1129005464 15:72369363-72369385 CAACAAAGTCAGCTGAAGAAAGG - Intronic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131550023 15:93349404-93349426 AAGCAATTACTGGTGAACAATGG + Intergenic
1131801597 15:96074940-96074962 CAACAATTACAGTTGAATCAGGG - Intergenic
1132444144 15:101896149-101896171 CAGCAATGACACCTGCAGACTGG + Intergenic
1133663186 16:7938913-7938935 CAGCATTTACAACTGGATAAAGG - Intergenic
1134798473 16:17063086-17063108 CAGAAATTCCAGCTGGAGAACGG - Intergenic
1135355966 16:21769271-21769293 CAGCAATGAGAACTGAATAAGGG + Intergenic
1135454456 16:22585410-22585432 CAGCAATGAGAACTGAATAAGGG + Intergenic
1136774893 16:32866699-32866721 CAGCAAGTATAGCTAAAAAAAGG - Intergenic
1136895724 16:33994813-33994835 CAGCAAGTATAGCTAAAAAAAGG + Intergenic
1137931858 16:52596258-52596280 CTTCAATTACAACTGAAAAAAGG - Intergenic
1139270146 16:65674297-65674319 CATAAATAACAGCTGAGGAAGGG - Intergenic
1140111233 16:72007273-72007295 CAGAAATTAGAGCAAAAGAAAGG - Intergenic
1141523531 16:84597086-84597108 CAGCTGTTCCAGCTGTAGAATGG + Intronic
1203077312 16_KI270728v1_random:1128808-1128830 CAGCAAGTATAGCTAAAAAAAGG - Intergenic
1143665857 17:8359673-8359695 CTGCACCTACAGATGAAGAAGGG + Intergenic
1144513314 17:15896235-15896257 CAGCAAATACAGCAAATGAAAGG + Intergenic
1147504849 17:41005817-41005839 CATCACTAACAGGTGAAGAAAGG - Intergenic
1150877038 17:68981902-68981924 CAGAAAGTACAGCTCAAGAAGGG + Intronic
1155292789 18:24358182-24358204 CAGCAACTCCAGCCTAAGAAGGG + Intronic
1156375166 18:36507910-36507932 GAGAAGTTAAAGCTGAAGAATGG - Intronic
1156585187 18:38424102-38424124 CAGCAAGTAAAGATGTAGAAAGG - Intergenic
1160641209 19:138666-138688 CAGCAATGACACCTGCAGACTGG - Intergenic
1161523341 19:4738270-4738292 CAGCAATTACAGCTAATAAACGG - Intergenic
1163073895 19:14870909-14870931 CACCAATTACAGCATTAGAAAGG + Intergenic
1164663338 19:29999880-29999902 AAGTAATTACATCTGAGGAATGG - Intronic
1167856485 19:52245758-52245780 CAGCAATGACAGCTGACTTAGGG + Intergenic
925551447 2:5079812-5079834 CAGCAACTCCAGGAGAAGAAGGG - Intergenic
926159032 2:10475154-10475176 CTGCAATGACATCTGTAGAACGG + Intergenic
928163474 2:28951150-28951172 AAGAAACTACAGCTAAAGAATGG - Intergenic
928734844 2:34276249-34276271 CAGCAAAAACTGCTAAAGAAAGG + Intergenic
929027056 2:37614963-37614985 CAACAATTTCTTCTGAAGAAAGG + Intergenic
930148887 2:48037668-48037690 CAGCTAATACAGATGATGAAAGG - Intergenic
930919251 2:56731762-56731784 CACCAATAACAGCAGAAGTATGG - Intergenic
931141458 2:59462969-59462991 CAGCAATGACTGCTGAAGGAAGG - Intergenic
931291823 2:60880963-60880985 CAGGAATTACAGAAGAAGACAGG + Intergenic
932200873 2:69827564-69827586 CTGAATTTACATCTGAAGAAGGG - Intergenic
935804989 2:106736697-106736719 CAGCATTTAGACCTGAATAAAGG - Intergenic
939851858 2:147313835-147313857 AAAGAATGACAGCTGAAGAAAGG + Intergenic
940053304 2:149487040-149487062 TAGCAGTTATTGCTGAAGAATGG - Intergenic
940748193 2:157594844-157594866 CAGCAATTAGAGCTTAAAACTGG + Intronic
941572467 2:167188994-167189016 CTCAAATTAAAGCTGAAGAAAGG - Intronic
942153235 2:173099636-173099658 AAATAATTACAGCTGAAGAATGG - Intronic
943336748 2:186624391-186624413 CAGCAATTGGAGGTGAAGGATGG + Intronic
944383502 2:199139176-199139198 CACCTATTAGAGCTGTAGAATGG - Intergenic
945220019 2:207473964-207473986 CAGCAAGAACAGCTGTAGGAAGG - Intergenic
945681529 2:212919599-212919621 CAGCAATGAAAGCTCCAGAAAGG - Intergenic
1170350976 20:15440634-15440656 CAGCATTTAAAGCTGATGAAGGG - Intronic
1172575848 20:36008075-36008097 CATCTATTACATCTGGAGAAGGG - Intronic
1175680357 20:60983681-60983703 TAGAAATGACAGCTGATGAATGG + Intergenic
952179948 3:30907009-30907031 CAGCAATTAAGGCTGACAAATGG - Intergenic
953165557 3:40461819-40461841 CTACAACTACATCTGAAGAAAGG - Intronic
953578477 3:44132268-44132290 CAGCATTTACAGATGAGCAATGG - Intergenic
953659693 3:44883118-44883140 AAGCAATCACAGCTGGAAAAGGG - Intronic
954320824 3:49831003-49831025 CAACCTTTACAGCGGAAGAAGGG + Intronic
954344451 3:49985017-49985039 CAGCAATTCTATCTAAAGAAGGG - Intronic
955955670 3:64286923-64286945 CAGCAATGACAGGTAAAGATAGG - Intronic
956085462 3:65604379-65604401 TAGCAAATACTGCTGGAGAAAGG + Intronic
957803034 3:85110091-85110113 CAGCAATTTCATCCGAAGCAGGG + Intronic
958714321 3:97761801-97761823 CAGAAATTGCAGATGAAAAAAGG + Intergenic
964952887 3:162318004-162318026 CAGCAATTTCTGCTGATGGATGG + Intergenic
965275682 3:166678722-166678744 CAGCAATGACAGTTTAATAATGG + Intergenic
965907814 3:173731279-173731301 TAGCAATAAAATCTGAAGAATGG + Intronic
965936956 3:174126153-174126175 CAGCAAATCCAGTTCAAGAAAGG - Intronic
969981923 4:11166468-11166490 CAGCAGCTACATCTGAAGGAGGG + Intergenic
970268162 4:14312596-14312618 CAGCTATTTCAGCCTAAGAAAGG + Intergenic
971876810 4:32318717-32318739 CAGGAATACCAGCTGCAGAAAGG - Intergenic
972878897 4:43399311-43399333 AAGAAATCACAGCTGAAGAAGGG - Intergenic
975595846 4:76047707-76047729 ATGGAATGACAGCTGAAGAAAGG - Intronic
977481230 4:97578429-97578451 CTTCAATTGCATCTGAAGAAGGG + Intronic
978268628 4:106859703-106859725 GACCAATTGCAGTTGAAGAAGGG + Intergenic
979098523 4:116583773-116583795 AACCCATTGCAGCTGAAGAAAGG - Intergenic
981569604 4:146137448-146137470 CATTAATTACAGGTGATGAAAGG + Intergenic
981623488 4:146730783-146730805 CAGCAATTTCAGTTGAAGGTGGG + Intronic
983420644 4:167510900-167510922 CAGCAATGACTGCTGAAGTTGGG + Intergenic
985214234 4:187633227-187633249 CAGCATTTCCAGCAGAAGCAAGG - Intergenic
986364387 5:7016274-7016296 AAGGAATTAAAGGTGAAGAAGGG - Intergenic
986827764 5:11540294-11540316 CAGCAAGTACATGTCAAGAAGGG - Intronic
988164686 5:27571321-27571343 CAGTAATTGAAACTGAAGAAAGG - Intergenic
988168335 5:27623557-27623579 CAGCCATGACAGCTGAGGTAAGG + Intergenic
989022348 5:37023462-37023484 CAGAAAGTACAGATGAAGTATGG - Intronic
989821702 5:45800712-45800734 CAGAAGTTCCAGCTGCAGAAAGG + Intergenic
990663825 5:58049524-58049546 CAGAAATTAAACCAGAAGAAAGG - Intergenic
994036604 5:95208970-95208992 GAGCAATTGCAGGAGAAGAAAGG - Intronic
994619451 5:102145826-102145848 CAGCAACTCCAGCCTAAGAATGG - Intergenic
995752965 5:115472822-115472844 AGGCGATGACAGCTGAAGAAAGG + Intergenic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996112687 5:119584027-119584049 CAGTAATTTCAGCTCAAGGATGG + Intronic
998696521 5:144646812-144646834 CTGCAGTGGCAGCTGAAGAATGG - Intergenic
998952180 5:147403481-147403503 CTGCAATTTCATCTGAAAAAAGG + Intronic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1001472138 5:172021980-172022002 CAGCAATCCCAGCTGGATAAGGG - Intergenic
1002736142 5:181387755-181387777 CAGCAATGACACCTGCAGACTGG + Intergenic
1002748556 6:87069-87091 CAGCAATGACACCTGCAGACTGG - Intergenic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1003329277 6:5116338-5116360 GAGCCATTACAGAAGAAGAAGGG + Intronic
1004461579 6:15841734-15841756 CATTAATTACATCTGAGGAAAGG - Intergenic
1005784639 6:29230580-29230602 CAGAATTTACAATTGAAGAATGG - Intergenic
1006088075 6:31610914-31610936 CAGCAATTCCATCTTAATAAGGG - Intergenic
1006183269 6:32166609-32166631 CAGCACTTACAGGTGAGGGATGG + Exonic
1007717345 6:43864963-43864985 CAGCTTTTACAGCTGGAAAAGGG - Intergenic
1007957849 6:45933464-45933486 CTGCAGTTACAACTGATGAAGGG + Intronic
1008300824 6:49837237-49837259 AAACACTTACAGGTGAAGAAAGG + Intronic
1010260573 6:73811282-73811304 CAGCAAATTCAGCCAAAGAAGGG - Intronic
1011947628 6:92926313-92926335 CAACAAATACAGCTGAAAGAAGG + Intergenic
1012345888 6:98185341-98185363 CATCAATGACAGATGAAGTAAGG + Intergenic
1016165497 6:140937220-140937242 CAGCAATCAAACCTGAAAAATGG - Intergenic
1018446271 6:163861954-163861976 CAAAAATCTCAGCTGAAGAAGGG - Intergenic
1019056898 6:169230445-169230467 CAGCACTTACAGATTAAGAAAGG + Intronic
1019148613 6:169989348-169989370 CAGCAGTAGCAGCTGAGGAAAGG - Intergenic
1019179324 6:170176856-170176878 CAGCTATTACTGCTGATCAAAGG + Intergenic
1019241239 6:170663283-170663305 CAGCAATGACACCTGCAGACTGG + Intergenic
1020223658 7:6262080-6262102 CAGCAATTACAGCTGAAGAAAGG + Intronic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1022222220 7:28324560-28324582 CAGCATTTACAGCTCTAGCAGGG - Intronic
1023174204 7:37419960-37419982 CAGCAATTACAAATGATGATAGG - Intronic
1023358373 7:39390605-39390627 CATCAACTACAGCTAAAGGAAGG - Intronic
1026889984 7:73976175-73976197 CAGCAACCATAGCTGAAGGAGGG - Intergenic
1027954518 7:84861876-84861898 CCACATTGACAGCTGAAGAAAGG - Intergenic
1028165692 7:87536135-87536157 CAGTAATTGCTACTGAAGAAAGG - Intronic
1030634000 7:111927452-111927474 CAGCAATGAAAGCTGGAGAGGGG + Intronic
1030701920 7:112649290-112649312 CAACAAAGAAAGCTGAAGAACGG + Intergenic
1032948517 7:136880066-136880088 GAGCAATTGCAGCTGAGGAATGG - Intronic
1034025955 7:147704416-147704438 AAGCAATTCCTTCTGAAGAAAGG + Intronic
1035506877 8:144812-144834 CAGCAATGACACCTGCAGACTGG - Intergenic
1036603743 8:10287877-10287899 AAGCAATTACTGCTGGAGAAGGG - Intronic
1037562469 8:20087260-20087282 CAGCACTTAGAGGAGAAGAAAGG + Intergenic
1038172467 8:25148906-25148928 CAGCTATTACTGTGGAAGAAGGG - Intergenic
1038438740 8:27557227-27557249 CAGTAATGCCAGGTGAAGAAAGG + Intergenic
1040065833 8:43143046-43143068 AAGCCATTAAAACTGAAGAAGGG + Intronic
1042193268 8:66209604-66209626 GAGCAAACACAGCTGAGGAATGG + Intergenic
1042791603 8:72613796-72613818 CTGAATTTACAGCAGAAGAAAGG - Intronic
1046083299 8:109399317-109399339 AACCAAATTCAGCTGAAGAAGGG + Intronic
1047868938 8:129060935-129060957 CATCAATAACATCTGAATAAAGG + Intergenic
1048350585 8:133612721-133612743 GAGGAATTAAAGGTGAAGAAAGG + Intergenic
1048417282 8:134241608-134241630 CAGCAAATGTATCTGAAGAAAGG + Intergenic
1051072597 9:13190151-13190173 CAGCACATAGAGCTGGAGAAAGG - Exonic
1051412211 9:16801536-16801558 CAGCATTTAAAGGTGAGGAATGG - Intronic
1052399741 9:27985784-27985806 CAGCAAACAGAGCAGAAGAAAGG + Intronic
1052502281 9:29306923-29306945 CAGCCATTTTAGCTCAAGAAAGG - Intergenic
1055292757 9:74800688-74800710 AAGGAATTACAGCTCAGGAAAGG + Intronic
1056345139 9:85685819-85685841 TGACAATCACAGCTGAAGAATGG + Intronic
1058170967 9:101680789-101680811 CAGCAAATACATGTGAACAAAGG + Intronic
1203601430 Un_KI270748v1:12517-12539 CAGCAATGACACCTGCAGACTGG + Intergenic
1186989701 X:15054235-15054257 CATCAATTACACCAGAATAAAGG - Intergenic
1187018801 X:15358177-15358199 CTGCAGTTATAGATGAAGAATGG - Exonic
1187474960 X:19602396-19602418 CTGTAAGTACAGCTGGAGAAGGG + Intronic
1188173029 X:26951486-26951508 CCACAATTACACCTGAATAATGG + Intergenic
1189678353 X:43487151-43487173 CAGCAATGACAGCACAAGATTGG - Intergenic
1189902143 X:45717532-45717554 TAGCAATTACACCTCAATAAAGG + Intergenic
1192043281 X:67645340-67645362 CAGAAGTTAGAGCTGAAGGAGGG + Intronic
1194877711 X:99209469-99209491 CAAAAATTAAAGATGAAGAAAGG - Intergenic
1195138612 X:101935437-101935459 CACCAAATGCAGCTGAAGGATGG - Intergenic
1195554384 X:106205129-106205151 GAGCAATTACAAATGGAGAAGGG - Intronic
1195800932 X:108709272-108709294 CAACAATTATAGCTGGAGACTGG - Intergenic
1196646941 X:118128109-118128131 CAGGCATTATAGATGAAGAACGG + Intergenic
1198069116 X:133130463-133130485 CAGCCAAGACAGATGAAGAAAGG + Intergenic
1199675099 X:150182052-150182074 AAGCAGTTACTGCTGCAGAAGGG - Intergenic
1201407540 Y:13663887-13663909 CTAGAATGACAGCTGAAGAAAGG - Intergenic
1201499855 Y:14630006-14630028 CAGCAATGACAGGTGAAGGGAGG - Intronic