ID: 1020223749

View in Genome Browser
Species Human (GRCh38)
Location 7:6263081-6263103
Sequence AGATGGACATACTGTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020223749 Original CRISPR AGATGGACATACTGTCAGCT TGG (reversed) Intronic
900011591 1:115725-115747 AGCTGGACAAACTGTGTGCTGGG - Intergenic
900247492 1:1644195-1644217 AAAAGGAAAAACTGTCAGCTAGG + Intronic
900258716 1:1711332-1711354 AAAAGGAAAAACTGTCAGCTAGG + Intronic
903808297 1:26020895-26020917 GGATGGGCATAATGTCAGCCAGG - Intronic
904613506 1:31737763-31737785 AGATGGGCAGACAGTCAGATGGG + Intronic
906391112 1:45417213-45417235 AGAAGGAAATACTGTCATTTGGG - Intronic
908578839 1:65491733-65491755 AGATGGAAACATTGTGAGCTGGG + Intronic
917034749 1:170735955-170735977 AGATGGATGTACTCTCAGCATGG - Intronic
918502610 1:185215222-185215244 AGATGGACAGACAGACAGGTGGG - Intronic
920399025 1:205665650-205665672 GGCTGGGCATCCTGTCAGCTTGG - Intronic
922430511 1:225547809-225547831 AGTTGGACATACTGTAGGCATGG - Intronic
923363354 1:233234877-233234899 AGAACTACATACTGGCAGCTGGG + Intronic
1064424800 10:15221183-15221205 AGATGGCCAAAGTGTCATCTAGG + Intronic
1072021100 10:91402610-91402632 AGAAGGAAATCCTGTCAGTTGGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072976881 10:100066511-100066533 GGTTAGACATACTGTCAGATGGG + Intronic
1073874231 10:107902703-107902725 ATATGCACTTACTTTCAGCTTGG - Intergenic
1077944649 11:6882655-6882677 AGAAGAAAATACTGTCAGGTTGG - Intergenic
1078151991 11:8767168-8767190 AGAGGGACAGACTATCAGTTTGG + Intronic
1078264355 11:9742700-9742722 AGAGGGACTTTCTGTCAGATTGG + Intronic
1080662566 11:34309297-34309319 AGTTGGGGATACAGTCAGCTGGG + Intronic
1080799306 11:35594821-35594843 AGCTGGACAGTCTGTCAACTTGG - Intergenic
1080908558 11:36572049-36572071 AGATGAACATACTTTGAGCAGGG - Intronic
1084425566 11:69082118-69082140 AGTGGGACATACTGTCAGGTGGG - Intronic
1087189557 11:95238451-95238473 AGATGGACATACCTTTAGCTTGG - Intergenic
1087770984 11:102209836-102209858 AGTTGTACATCCTATCAGCTAGG + Intronic
1088712688 11:112522984-112523006 AGCTGGGCATACTGTCACCTGGG - Intergenic
1089394280 11:118125365-118125387 TGATGGAGCTACGGTCAGCTCGG + Intergenic
1099159559 12:79223909-79223931 AGAAAGAGATACTGTCAACTTGG - Intronic
1100021395 12:90073683-90073705 AGATTGGCAAAATGTCAGCTTGG + Intergenic
1100237625 12:92676871-92676893 AGATGGAAAAACAGTCAGCCAGG + Intergenic
1102760525 12:115380916-115380938 AGTTGGAGATACTCTCAGCAAGG - Intergenic
1103241813 12:119419770-119419792 AGAAGGAGAGACTGTCATCTGGG - Intronic
1104664155 12:130635547-130635569 TGGTGGCCATTCTGTCAGCTTGG - Intronic
1108671563 13:52695081-52695103 ATATGGGCTCACTGTCAGCTGGG + Intronic
1110290037 13:73794700-73794722 AGAATGACACACTGACAGCTGGG - Intronic
1114335275 14:21682862-21682884 AGAGGGACATACTTTCAGGGAGG - Intergenic
1125024279 15:35015062-35015084 AGAGAGACATAATGTCAGCATGG + Intergenic
1130732416 15:86510944-86510966 AGAGAGACATAATATCAGCTTGG + Intronic
1133028647 16:2999335-2999357 AGAGGGACAAACTCTCAGCTAGG + Intergenic
1134026751 16:10959938-10959960 AGATGGACAGGGTGTCATCTTGG - Intronic
1134852650 16:17493816-17493838 ATATGGATATATTGTCATCTTGG - Intergenic
1135506613 16:23043004-23043026 AGATAGACAGACTGAAAGCTAGG - Intergenic
1137385100 16:48034147-48034169 CAATGGAAATACTGCCAGCTTGG - Intergenic
1138533076 16:57645644-57645666 TGATGGACATACTGCAGGCTTGG - Intronic
1141219507 16:82056139-82056161 AGAATGACATCCTGTCAGCCAGG + Intronic
1141552503 16:84815582-84815604 ACATGGCCATCCCGTCAGCTTGG - Intergenic
1147449712 17:40496371-40496393 AGGAGGCCATGCTGTCAGCTTGG - Exonic
1147785392 17:42974807-42974829 CTATGGACAGACTCTCAGCTTGG + Intronic
1148193455 17:45696678-45696700 AGATTGACACACTGTCATATAGG + Intergenic
1148538035 17:48457018-48457040 AGATGGCCTGGCTGTCAGCTCGG + Intergenic
1149523932 17:57339622-57339644 AAATGGATATACTGTCATCATGG - Intronic
1151090659 17:71436536-71436558 AGATGTACATACATTCATCTGGG - Intergenic
1151214539 17:72568685-72568707 AGATGGAAACACTGTCTGCCAGG - Intergenic
1158429722 18:57374670-57374692 ACATGGAAATACTTTCTGCTAGG - Intergenic
1163901255 19:20102151-20102173 AGATGAACATACTGACATTTTGG - Intronic
1164438007 19:28249082-28249104 TGATGGACAGACTGTAAGTTGGG + Intergenic
1164535162 19:29080453-29080475 AGATGGACATACAGCAGGCTTGG - Intergenic
1166903989 19:46090948-46090970 AGAGATACATACTGTCTGCTTGG - Intergenic
927807496 2:26161041-26161063 AGATGGACTTGGTGTCATCTGGG - Intergenic
928963877 2:36957560-36957582 AGATGGTCTTACTGTCACCCAGG - Intronic
935950160 2:108321697-108321719 AGGTGCACATGTTGTCAGCTGGG - Intergenic
936626252 2:114152565-114152587 AGATGGACATTCTGACAGGCTGG + Intergenic
937339261 2:121080489-121080511 AGATGGACACACTCTCTGCCAGG - Intergenic
938632782 2:133186857-133186879 AGATTGACAGACTGCTAGCTAGG - Intronic
941294399 2:163718008-163718030 AGATGCACAGATTGTCTGCTTGG - Intronic
943228531 2:185212995-185213017 AGTTGGAAATACGATCAGCTAGG + Intergenic
944671992 2:202002573-202002595 ACACGGACCCACTGTCAGCTTGG + Intergenic
945935460 2:215898974-215898996 AGAAGGACCTACTCTCTGCTAGG + Intergenic
948548527 2:238750837-238750859 AGATGGACAGACTGTGAGAGAGG + Intergenic
1169632731 20:7650965-7650987 AGATGGATTTCCTGTCAGTTCGG + Intergenic
1169859940 20:10140839-10140861 GGATGGACATTCTGTCAGGAAGG - Intergenic
1171413979 20:24965227-24965249 AGATGGCAAGACTGGCAGCTGGG - Intronic
1173398224 20:42700911-42700933 AGATGGACATTCTGCCTCCTAGG + Intronic
1173560868 20:44004455-44004477 AGATGGGCAAACAGTCATCTGGG - Intronic
1173639458 20:44590427-44590449 AGGTGGCCATACTGCCAGGTGGG - Intronic
1178015858 21:28345362-28345384 AGATGAAAATGCTGACAGCTAGG + Intergenic
1178556908 21:33600108-33600130 AAATCGAAACACTGTCAGCTGGG + Intronic
1179112939 21:38463036-38463058 AGATGGACACACTGGGAGATAGG - Intronic
1182313861 22:29429383-29429405 AAATTGACAAACTGTGAGCTAGG + Intergenic
950888100 3:16378224-16378246 ACATGGAGTTCCTGTCAGCTTGG - Intronic
951734683 3:25851258-25851280 AGATGGAGCTGCTGTCAGCCAGG + Intergenic
951879349 3:27464894-27464916 AGATGGACAGCCTGTTAGCCAGG + Intronic
952662349 3:35866874-35866896 AGATGATCACAGTGTCAGCTGGG + Intergenic
955960066 3:64331438-64331460 AGGGGGACATACTGGGAGCTGGG + Intronic
958638369 3:96775163-96775185 ATAAAGACATACTGCCAGCTGGG + Intergenic
959110685 3:102118711-102118733 AGAAGGACATCCTGTCATTTAGG - Intronic
963253866 3:143125176-143125198 TGACGGACATATTGCCAGCTTGG - Intergenic
965462876 3:168990357-168990379 AGATGATCATACTGTTAGTTTGG + Intergenic
965630436 3:170727058-170727080 AGATGGACAGACAGTCAGTTGGG - Intronic
965705642 3:171504655-171504677 AGATGGAGCTTCTGTCAGCCTGG - Intergenic
967478655 3:189949390-189949412 ATATGGAGATACTGTCAGGAAGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969144774 4:5113026-5113048 AGATGGAGCCTCTGTCAGCTGGG + Intronic
977104518 4:92864414-92864436 AGATGGCAGTACTGTCATCTTGG - Intronic
981116021 4:140992500-140992522 AGGTGGCCACACAGTCAGCTGGG + Intronic
988494515 5:31733582-31733604 AGAGGCACATGCTCTCAGCTGGG + Intronic
990857529 5:60286742-60286764 ATATTGACTTACTGTCAGATAGG + Intronic
991970519 5:72136458-72136480 ACAGGGCCATACTGACAGCTTGG - Intronic
992321925 5:75621884-75621906 AGATTGAAATAATGTCAGGTGGG + Intronic
992457344 5:76927927-76927949 AGATGGGCTTAGAGTCAGCTGGG - Intergenic
996230739 5:121060716-121060738 AGCTGGACTCACTGTCAGTTAGG - Intergenic
996672663 5:126136203-126136225 AGATCCAAATACTGTCACCTTGG - Intergenic
997930491 5:138068713-138068735 AAATGGATATAATGCCAGCTGGG + Intergenic
1000265971 5:159637895-159637917 AAATTGACATACTTTTAGCTAGG + Intergenic
1001145863 5:169183949-169183971 AGAAGTACATTCTGCCAGCTTGG - Intronic
1001171086 5:169419580-169419602 AGAAGGAGAGACTGTCAGGTAGG - Intergenic
1007863888 6:44946089-44946111 AAATGGATATGCTGTCATCTAGG - Intronic
1010407647 6:75522924-75522946 AGACGCACATACTGGCAGTTAGG + Intergenic
1011799090 6:90990857-90990879 AGATGTACATACTTTGAGGTTGG - Intergenic
1015909978 6:138161033-138161055 AGAGGGGCAGACTGGCAGCTGGG - Intergenic
1020223749 7:6263081-6263103 AGATGGACATACTGTCAGCTTGG - Intronic
1023916190 7:44591121-44591143 GGCTGGACCTCCTGTCAGCTGGG - Intergenic
1024340939 7:48258490-48258512 AGATTGATAGACTGTTAGCTAGG - Intronic
1026548220 7:71343575-71343597 AAATGGAAAGACTGACAGCTTGG - Intronic
1027919420 7:84373367-84373389 ACATGGACATATTTTCAACTAGG + Intronic
1032980153 7:137272461-137272483 AGATAGCGATACTGTCATCTTGG - Intronic
1033509709 7:142047709-142047731 TGATGGAAATATTCTCAGCTCGG + Intronic
1037756840 8:21715680-21715702 ATAAGGAAATAATGTCAGCTGGG + Intronic
1039759551 8:40559583-40559605 AGATGGGCATTCTGACAGGTTGG - Intronic
1043473678 8:80585382-80585404 AGATGGAGCCTCTGTCAGCTGGG + Intergenic
1044427142 8:92064990-92065012 AGATGCACACACATTCAGCTAGG - Intronic
1045286521 8:100796456-100796478 AGGTAGACATAATGTCAGGTGGG - Intergenic
1048174477 8:132139807-132139829 AGGTGGAAATACTGTCAGGAGGG + Intronic
1051256315 9:15217366-15217388 AGCTGGCCACACTGTCACCTGGG + Intronic
1052204431 9:25821984-25822006 AGATGGAAATCCTGTCATCTAGG - Intergenic
1052651913 9:31315097-31315119 AGATTTACATACAGTCAACTAGG + Intergenic
1054963542 9:70996390-70996412 AGATGGGCATAGTGACACCTTGG - Intronic
1057299238 9:93867433-93867455 AGAAGGACGTCCTGTCATCTTGG - Intergenic
1059772704 9:117442886-117442908 AGGTGCACTTGCTGTCAGCTTGG - Intergenic
1061668427 9:132174114-132174136 AGATGGACAGACGGACAGATAGG + Intronic
1185759188 X:2676514-2676536 AGATGGAGTCTCTGTCAGCTGGG + Intergenic
1186852472 X:13593886-13593908 AGGTGGACCTACTGTGAGCCAGG + Intronic
1187936700 X:24343296-24343318 AAATGGACATACTATCACCAAGG - Intergenic
1189163459 X:38834933-38834955 ATAAGGACATCTTGTCAGCTGGG + Intergenic
1189241157 X:39525840-39525862 AGGTGCAGGTACTGTCAGCTGGG - Intergenic
1191700910 X:64041951-64041973 AAATGGACAAACTGTTAGCCAGG + Intergenic
1194009572 X:88543910-88543932 AAATTGACAAACTGTTAGCTAGG - Intergenic
1194385973 X:93255583-93255605 AGAATGACATTCTGTAAGCTGGG - Intergenic
1195559486 X:106267226-106267248 AGATGGATATTATGTCCGCTGGG + Intergenic
1195562475 X:106299113-106299135 AGATGGATATTATGTCCGCTGGG - Intergenic
1195862612 X:109397863-109397885 AGAAGGGCATAATGTCACCTCGG - Intronic
1200295778 X:154918514-154918536 TGATGTACATACTGTCAGTCTGG + Intronic
1201962396 Y:19696094-19696116 AAATGTCCATACTATCAGCTAGG + Intergenic