ID: 1020228373 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:6298003-6298025 |
| Sequence | GTCGCCCAGGTGTAGTGTAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1020228373_1020228379 | 17 | Left | 1020228373 | 7:6298003-6298025 | CCACTACACTACACCTGGGCGAC | No data | ||
| Right | 1020228379 | 7:6298043-6298065 | CAATACCAAACAAACAAAAAAGG | No data | ||||
| 1020228373_1020228382 | 22 | Left | 1020228373 | 7:6298003-6298025 | CCACTACACTACACCTGGGCGAC | No data | ||
| Right | 1020228382 | 7:6298048-6298070 | CCAAACAAACAAAAAAGGCCGGG | No data | ||||
| 1020228373_1020228380 | 21 | Left | 1020228373 | 7:6298003-6298025 | CCACTACACTACACCTGGGCGAC | No data | ||
| Right | 1020228380 | 7:6298047-6298069 | ACCAAACAAACAAAAAAGGCCGG | No data | ||||
| 1020228373_1020228383 | 30 | Left | 1020228373 | 7:6298003-6298025 | CCACTACACTACACCTGGGCGAC | No data | ||
| Right | 1020228383 | 7:6298056-6298078 | ACAAAAAAGGCCGGGAACAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1020228373 | Original CRISPR | GTCGCCCAGGTGTAGTGTAG TGG (reversed) | Intergenic | ||