ID: 1020228376

View in Genome Browser
Species Human (GRCh38)
Location 7:6298016-6298038
Sequence AGGGTCTTGCCCTGTCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020228376_1020228382 9 Left 1020228376 7:6298016-6298038 CCTGGGCGACAGGGCAAGACCCT No data
Right 1020228382 7:6298048-6298070 CCAAACAAACAAAAAAGGCCGGG No data
1020228376_1020228383 17 Left 1020228376 7:6298016-6298038 CCTGGGCGACAGGGCAAGACCCT No data
Right 1020228383 7:6298056-6298078 ACAAAAAAGGCCGGGAACAGTGG No data
1020228376_1020228380 8 Left 1020228376 7:6298016-6298038 CCTGGGCGACAGGGCAAGACCCT No data
Right 1020228380 7:6298047-6298069 ACCAAACAAACAAAAAAGGCCGG No data
1020228376_1020228379 4 Left 1020228376 7:6298016-6298038 CCTGGGCGACAGGGCAAGACCCT No data
Right 1020228379 7:6298043-6298065 CAATACCAAACAAACAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020228376 Original CRISPR AGGGTCTTGCCCTGTCGCCC AGG (reversed) Intergenic