ID: 1020228377

View in Genome Browser
Species Human (GRCh38)
Location 7:6298035-6298057
Sequence GTTTGTTTGGTATTGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020228377_1020228383 -2 Left 1020228377 7:6298035-6298057 CCCTGTCTCAATACCAAACAAAC No data
Right 1020228383 7:6298056-6298078 ACAAAAAAGGCCGGGAACAGTGG No data
1020228377_1020228385 25 Left 1020228377 7:6298035-6298057 CCCTGTCTCAATACCAAACAAAC No data
Right 1020228385 7:6298083-6298105 CGCCTGTAATCCCCGTATTTTGG No data
1020228377_1020228388 29 Left 1020228377 7:6298035-6298057 CCCTGTCTCAATACCAAACAAAC No data
Right 1020228388 7:6298087-6298109 TGTAATCCCCGTATTTTGGGAGG No data
1020228377_1020228382 -10 Left 1020228377 7:6298035-6298057 CCCTGTCTCAATACCAAACAAAC No data
Right 1020228382 7:6298048-6298070 CCAAACAAACAAAAAAGGCCGGG No data
1020228377_1020228386 26 Left 1020228377 7:6298035-6298057 CCCTGTCTCAATACCAAACAAAC No data
Right 1020228386 7:6298084-6298106 GCCTGTAATCCCCGTATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020228377 Original CRISPR GTTTGTTTGGTATTGAGACA GGG (reversed) Intergenic