ID: 1020228378

View in Genome Browser
Species Human (GRCh38)
Location 7:6298036-6298058
Sequence TGTTTGTTTGGTATTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020228378_1020228383 -3 Left 1020228378 7:6298036-6298058 CCTGTCTCAATACCAAACAAACA No data
Right 1020228383 7:6298056-6298078 ACAAAAAAGGCCGGGAACAGTGG No data
1020228378_1020228388 28 Left 1020228378 7:6298036-6298058 CCTGTCTCAATACCAAACAAACA No data
Right 1020228388 7:6298087-6298109 TGTAATCCCCGTATTTTGGGAGG No data
1020228378_1020228385 24 Left 1020228378 7:6298036-6298058 CCTGTCTCAATACCAAACAAACA No data
Right 1020228385 7:6298083-6298105 CGCCTGTAATCCCCGTATTTTGG No data
1020228378_1020228386 25 Left 1020228378 7:6298036-6298058 CCTGTCTCAATACCAAACAAACA No data
Right 1020228386 7:6298084-6298106 GCCTGTAATCCCCGTATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020228378 Original CRISPR TGTTTGTTTGGTATTGAGAC AGG (reversed) Intergenic