ID: 1020228379 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:6298043-6298065 |
Sequence | CAATACCAAACAAACAAAAA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1020228376_1020228379 | 4 | Left | 1020228376 | 7:6298016-6298038 | CCTGGGCGACAGGGCAAGACCCT | No data | ||
Right | 1020228379 | 7:6298043-6298065 | CAATACCAAACAAACAAAAAAGG | No data | ||||
1020228373_1020228379 | 17 | Left | 1020228373 | 7:6298003-6298025 | CCACTACACTACACCTGGGCGAC | No data | ||
Right | 1020228379 | 7:6298043-6298065 | CAATACCAAACAAACAAAAAAGG | No data | ||||
1020228372_1020228379 | 18 | Left | 1020228372 | 7:6298002-6298024 | CCCACTACACTACACCTGGGCGA | No data | ||
Right | 1020228379 | 7:6298043-6298065 | CAATACCAAACAAACAAAAAAGG | No data | ||||
1020228371_1020228379 | 19 | Left | 1020228371 | 7:6298001-6298023 | CCCCACTACACTACACCTGGGCG | No data | ||
Right | 1020228379 | 7:6298043-6298065 | CAATACCAAACAAACAAAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1020228379 | Original CRISPR | CAATACCAAACAAACAAAAA AGG | Intergenic | ||