ID: 1020228379

View in Genome Browser
Species Human (GRCh38)
Location 7:6298043-6298065
Sequence CAATACCAAACAAACAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020228376_1020228379 4 Left 1020228376 7:6298016-6298038 CCTGGGCGACAGGGCAAGACCCT No data
Right 1020228379 7:6298043-6298065 CAATACCAAACAAACAAAAAAGG No data
1020228373_1020228379 17 Left 1020228373 7:6298003-6298025 CCACTACACTACACCTGGGCGAC No data
Right 1020228379 7:6298043-6298065 CAATACCAAACAAACAAAAAAGG No data
1020228372_1020228379 18 Left 1020228372 7:6298002-6298024 CCCACTACACTACACCTGGGCGA No data
Right 1020228379 7:6298043-6298065 CAATACCAAACAAACAAAAAAGG No data
1020228371_1020228379 19 Left 1020228371 7:6298001-6298023 CCCCACTACACTACACCTGGGCG No data
Right 1020228379 7:6298043-6298065 CAATACCAAACAAACAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020228379 Original CRISPR CAATACCAAACAAACAAAAA AGG Intergenic