ID: 1020228382

View in Genome Browser
Species Human (GRCh38)
Location 7:6298048-6298070
Sequence CCAAACAAACAAAAAAGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020228377_1020228382 -10 Left 1020228377 7:6298035-6298057 CCCTGTCTCAATACCAAACAAAC No data
Right 1020228382 7:6298048-6298070 CCAAACAAACAAAAAAGGCCGGG No data
1020228371_1020228382 24 Left 1020228371 7:6298001-6298023 CCCCACTACACTACACCTGGGCG No data
Right 1020228382 7:6298048-6298070 CCAAACAAACAAAAAAGGCCGGG No data
1020228373_1020228382 22 Left 1020228373 7:6298003-6298025 CCACTACACTACACCTGGGCGAC No data
Right 1020228382 7:6298048-6298070 CCAAACAAACAAAAAAGGCCGGG No data
1020228376_1020228382 9 Left 1020228376 7:6298016-6298038 CCTGGGCGACAGGGCAAGACCCT No data
Right 1020228382 7:6298048-6298070 CCAAACAAACAAAAAAGGCCGGG No data
1020228372_1020228382 23 Left 1020228372 7:6298002-6298024 CCCACTACACTACACCTGGGCGA No data
Right 1020228382 7:6298048-6298070 CCAAACAAACAAAAAAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020228382 Original CRISPR CCAAACAAACAAAAAAGGCC GGG Intergenic