ID: 1020228383

View in Genome Browser
Species Human (GRCh38)
Location 7:6298056-6298078
Sequence ACAAAAAAGGCCGGGAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020228376_1020228383 17 Left 1020228376 7:6298016-6298038 CCTGGGCGACAGGGCAAGACCCT No data
Right 1020228383 7:6298056-6298078 ACAAAAAAGGCCGGGAACAGTGG No data
1020228373_1020228383 30 Left 1020228373 7:6298003-6298025 CCACTACACTACACCTGGGCGAC No data
Right 1020228383 7:6298056-6298078 ACAAAAAAGGCCGGGAACAGTGG No data
1020228378_1020228383 -3 Left 1020228378 7:6298036-6298058 CCTGTCTCAATACCAAACAAACA No data
Right 1020228383 7:6298056-6298078 ACAAAAAAGGCCGGGAACAGTGG No data
1020228377_1020228383 -2 Left 1020228377 7:6298035-6298057 CCCTGTCTCAATACCAAACAAAC No data
Right 1020228383 7:6298056-6298078 ACAAAAAAGGCCGGGAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020228383 Original CRISPR ACAAAAAAGGCCGGGAACAG TGG Intergenic