ID: 1020228384

View in Genome Browser
Species Human (GRCh38)
Location 7:6298066-6298088
Sequence CAGGCGTGAGCCACTGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020228384_1020228385 -6 Left 1020228384 7:6298066-6298088 CCGGGAACAGTGGCTCACGCCTG No data
Right 1020228385 7:6298083-6298105 CGCCTGTAATCCCCGTATTTTGG No data
1020228384_1020228395 12 Left 1020228384 7:6298066-6298088 CCGGGAACAGTGGCTCACGCCTG No data
Right 1020228395 7:6298101-6298123 TTTGGGAGGACAAGGCAGGTGGG No data
1020228384_1020228386 -5 Left 1020228384 7:6298066-6298088 CCGGGAACAGTGGCTCACGCCTG No data
Right 1020228386 7:6298084-6298106 GCCTGTAATCCCCGTATTTTGGG No data
1020228384_1020228388 -2 Left 1020228384 7:6298066-6298088 CCGGGAACAGTGGCTCACGCCTG No data
Right 1020228388 7:6298087-6298109 TGTAATCCCCGTATTTTGGGAGG No data
1020228384_1020228393 8 Left 1020228384 7:6298066-6298088 CCGGGAACAGTGGCTCACGCCTG No data
Right 1020228393 7:6298097-6298119 GTATTTTGGGAGGACAAGGCAGG No data
1020228384_1020228390 4 Left 1020228384 7:6298066-6298088 CCGGGAACAGTGGCTCACGCCTG No data
Right 1020228390 7:6298093-6298115 CCCCGTATTTTGGGAGGACAAGG No data
1020228384_1020228394 11 Left 1020228384 7:6298066-6298088 CCGGGAACAGTGGCTCACGCCTG No data
Right 1020228394 7:6298100-6298122 TTTTGGGAGGACAAGGCAGGTGG No data
1020228384_1020228396 27 Left 1020228384 7:6298066-6298088 CCGGGAACAGTGGCTCACGCCTG No data
Right 1020228396 7:6298116-6298138 CAGGTGGGTCACTTGACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020228384 Original CRISPR CAGGCGTGAGCCACTGTTCC CGG (reversed) Intergenic