ID: 1020228386

View in Genome Browser
Species Human (GRCh38)
Location 7:6298084-6298106
Sequence GCCTGTAATCCCCGTATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020228381_1020228386 13 Left 1020228381 7:6298048-6298070 CCAAACAAACAAAAAAGGCCGGG No data
Right 1020228386 7:6298084-6298106 GCCTGTAATCCCCGTATTTTGGG No data
1020228377_1020228386 26 Left 1020228377 7:6298035-6298057 CCCTGTCTCAATACCAAACAAAC No data
Right 1020228386 7:6298084-6298106 GCCTGTAATCCCCGTATTTTGGG No data
1020228384_1020228386 -5 Left 1020228384 7:6298066-6298088 CCGGGAACAGTGGCTCACGCCTG No data
Right 1020228386 7:6298084-6298106 GCCTGTAATCCCCGTATTTTGGG No data
1020228378_1020228386 25 Left 1020228378 7:6298036-6298058 CCTGTCTCAATACCAAACAAACA No data
Right 1020228386 7:6298084-6298106 GCCTGTAATCCCCGTATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020228386 Original CRISPR GCCTGTAATCCCCGTATTTT GGG Intergenic