ID: 1020228388

View in Genome Browser
Species Human (GRCh38)
Location 7:6298087-6298109
Sequence TGTAATCCCCGTATTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020228384_1020228388 -2 Left 1020228384 7:6298066-6298088 CCGGGAACAGTGGCTCACGCCTG No data
Right 1020228388 7:6298087-6298109 TGTAATCCCCGTATTTTGGGAGG No data
1020228381_1020228388 16 Left 1020228381 7:6298048-6298070 CCAAACAAACAAAAAAGGCCGGG No data
Right 1020228388 7:6298087-6298109 TGTAATCCCCGTATTTTGGGAGG No data
1020228378_1020228388 28 Left 1020228378 7:6298036-6298058 CCTGTCTCAATACCAAACAAACA No data
Right 1020228388 7:6298087-6298109 TGTAATCCCCGTATTTTGGGAGG No data
1020228377_1020228388 29 Left 1020228377 7:6298035-6298057 CCCTGTCTCAATACCAAACAAAC No data
Right 1020228388 7:6298087-6298109 TGTAATCCCCGTATTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020228388 Original CRISPR TGTAATCCCCGTATTTTGGG AGG Intergenic