ID: 1020231610

View in Genome Browser
Species Human (GRCh38)
Location 7:6323472-6323494
Sequence GCTTATTTTTGAAGTGATAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020231610_1020231614 -9 Left 1020231610 7:6323472-6323494 CCCGTATCACTTCAAAAATAAGC No data
Right 1020231614 7:6323486-6323508 AAAATAAGCATTATTAGGCCGGG No data
1020231610_1020231615 -1 Left 1020231610 7:6323472-6323494 CCCGTATCACTTCAAAAATAAGC No data
Right 1020231615 7:6323494-6323516 CATTATTAGGCCGGGCACAGTGG No data
1020231610_1020231617 26 Left 1020231610 7:6323472-6323494 CCCGTATCACTTCAAAAATAAGC No data
Right 1020231617 7:6323521-6323543 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
1020231610_1020231620 30 Left 1020231610 7:6323472-6323494 CCCGTATCACTTCAAAAATAAGC No data
Right 1020231620 7:6323525-6323547 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1020231610_1020231613 -10 Left 1020231610 7:6323472-6323494 CCCGTATCACTTCAAAAATAAGC No data
Right 1020231613 7:6323485-6323507 AAAAATAAGCATTATTAGGCCGG No data
1020231610_1020231618 27 Left 1020231610 7:6323472-6323494 CCCGTATCACTTCAAAAATAAGC No data
Right 1020231618 7:6323522-6323544 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020231610 Original CRISPR GCTTATTTTTGAAGTGATAC GGG (reversed) Intergenic
No off target data available for this crispr