ID: 1020232545

View in Genome Browser
Species Human (GRCh38)
Location 7:6330916-6330938
Sequence GGCCTCTGGCTTCACAGTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 1, 2: 6, 3: 34, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020232545 Original CRISPR GGCCTCTGGCTTCACAGTGG CGG (reversed) Exonic
900226240 1:1534832-1534854 GGCCCCTGGCCCCGCAGTGGCGG - Intergenic
900563784 1:3322525-3322547 CGCCACTGGCCTCAGAGTGGGGG - Intronic
901445886 1:9307922-9307944 CACCTCTGGCATCACAGTTGAGG - Intronic
901915010 1:12492153-12492175 GGCCGCAGGCCTAACAGTGGTGG + Intronic
902392846 1:16116170-16116192 GGCCTCTGACATCACAGCAGGGG - Intergenic
902620287 1:17646824-17646846 GGCCACTGGCTCCACCGTGCTGG - Intronic
902847370 1:19122578-19122600 GGCCACTCACCTCACAGTGGAGG + Intronic
903403895 1:23080270-23080292 AGCCTCTAACTTCACAGAGGGGG + Intronic
904804750 1:33122911-33122933 GGCATCTGGCTGCTGAGTGGAGG - Intergenic
906588507 1:47001740-47001762 GGACTGTGGCTTCAGTGTGGAGG - Intergenic
907108419 1:51904986-51905008 GGGCTGTGGCTTCCCAGAGGAGG + Intergenic
909176732 1:72371038-72371060 GGCCTTTGGCTGCAGAGTGAAGG + Intergenic
912415989 1:109508885-109508907 GGCCTCTCGGGTCACGGTGGGGG + Exonic
912566032 1:110588084-110588106 GGCCTTTGGCCTCAGACTGGGGG - Intergenic
916248336 1:162710347-162710369 GGCCTTTGGCTCCACACTGAGGG + Intronic
917790546 1:178496318-178496340 GCCCTCTGGCTGCAGAGTCGGGG - Intergenic
919133000 1:193474383-193474405 GGCCTCTTGCTTCAAGGTAGGGG + Intergenic
920534583 1:206729292-206729314 AGCCTCAGGCTGCACAGAGGTGG + Intronic
921280906 1:213567310-213567332 GGCTTCTGGCTTTATACTGGGGG + Intergenic
921735323 1:218621235-218621257 TGACTCTGGGTTCACAGTGAAGG + Intergenic
921880653 1:220250870-220250892 GGCCTCAGGAAACACAGTGGTGG - Intronic
922340375 1:224650251-224650273 CTCCTCAGTCTTCACAGTGGAGG - Intronic
922702835 1:227771777-227771799 GGCCCATGGCTTCAGAGTGATGG + Intronic
1065187601 10:23183893-23183915 TGCCGCTGGCTTTAAAGTGGGGG - Intergenic
1067686194 10:48467051-48467073 AGGTGCTGGCTTCACAGTGGGGG + Intronic
1068663393 10:59647121-59647143 GGGCTCTGGCTCCACACTGCTGG + Intergenic
1069921158 10:71816519-71816541 GGCCTCTGGCTTCCTGGTAGAGG - Exonic
1071478159 10:86042376-86042398 AGCCTCTGGGTGCACAGTGTGGG + Intronic
1072293825 10:93991353-93991375 GGTCTCTGACTTCATGGTGGTGG - Intergenic
1073074211 10:100813446-100813468 GGCCGCTGGCATCACACTGGAGG + Intronic
1073149011 10:101299006-101299028 GGCCTCTGGCTTCCTTCTGGGGG + Intergenic
1074875986 10:117613773-117613795 GGCCCCTGGCTCCATTGTGGGGG + Intergenic
1075941155 10:126391229-126391251 GGCCGCTTGCTTCACAGAGATGG - Intergenic
1076536939 10:131184770-131184792 AGCCTCTCGCCTCACAGAGGAGG + Intronic
1077213963 11:1387527-1387549 GGGCTGTGGCATCACAGTCGTGG + Intergenic
1077477503 11:2797348-2797370 CACCTCTGGCTGCCCAGTGGGGG - Intronic
1078065083 11:8073207-8073229 GGACTCTGCCTCCTCAGTGGTGG + Intronic
1078657514 11:13255495-13255517 TGCCTCTTCCTTCACTGTGGAGG - Intergenic
1080686775 11:34522507-34522529 GGCCTTCAGCTTCACTGTGGGGG + Intergenic
1080839250 11:35969158-35969180 GGCCTCTGTCTTCTCGGTCGAGG + Intronic
1081752009 11:45518097-45518119 GGCCTCAGGTTGCACACTGGAGG - Intergenic
1081777281 11:45684359-45684381 GGCCCCAGCCTTCCCAGTGGAGG + Intergenic
1082750183 11:57006384-57006406 GGCCTCTTGCTCCACAGAGAGGG - Intergenic
1083332156 11:61903933-61903955 GGCATCTGGCTAAGCAGTGGGGG - Intronic
1083343190 11:61972123-61972145 GGGCTGTGGCTTCACTGTGGAGG + Intergenic
1083844004 11:65320746-65320768 GGCTTCTGGCTACAGTGTGGGGG - Exonic
1084717025 11:70880564-70880586 TGCCCCTGGCCTCACAGAGGGGG - Intronic
1084942889 11:72623309-72623331 GGCTTCTGGCTTCACACTCCTGG + Intronic
1085025847 11:73236100-73236122 GCCAACTGGCTTTACAGTGGGGG - Exonic
1086440358 11:86823437-86823459 GCCCTCTCGCTTCACAGTTGTGG - Intronic
1086459231 11:86989361-86989383 GGCTGCTGGCTACTCAGTGGTGG - Intergenic
1088262864 11:107960810-107960832 GGGCTGTGGCTTAGCAGTGGTGG - Intronic
1088934397 11:114384532-114384554 AGCCATTGGCTTGACAGTGGTGG + Intergenic
1090077954 11:123591261-123591283 GGCCTCTGGTTTCTCAGCAGAGG - Intronic
1091260471 11:134230105-134230127 GGCCTCTGGAAGAACAGTGGAGG - Intronic
1091669651 12:2443664-2443686 GGCCTCTGGCTTCAGAGTTCAGG + Intronic
1091753707 12:3038413-3038435 GCCCTCTGGCTTCACAGTGGAGG + Intronic
1092725020 12:11476393-11476415 GGGCTCTGGCCTCACAGTCCTGG - Intronic
1093021956 12:14212295-14212317 GGACTTTGGCTTCACTGAGGTGG - Intergenic
1094450158 12:30575734-30575756 GGCCTCTGGCTTCACCCTGGAGG + Intergenic
1094498776 12:31005611-31005633 AGCCTCAGCCTTCTCAGTGGTGG - Intergenic
1096667999 12:53180054-53180076 GGCCTCGGGATTCGCAGAGGAGG + Intronic
1097022732 12:56032312-56032334 GGCATGTGGCTTCAGACTGGTGG - Intronic
1097954942 12:65474672-65474694 GGTCACTGGCTTCATTGTGGCGG - Intronic
1100227335 12:92572495-92572517 GGCCTCTGACCTCATGGTGGAGG - Intergenic
1100847777 12:98678559-98678581 GGCCTCCGGCTCCACAGAGCAGG + Intronic
1100860085 12:98795748-98795770 AGTCTCTGGATTCACAGTGTGGG + Intronic
1102187949 12:110964516-110964538 GTCTTCTGTCTTCCCAGTGGTGG + Intergenic
1104584166 12:130034500-130034522 GGGCTCTGACTGCACTGTGGAGG - Intergenic
1105433516 13:20358303-20358325 GATCTCTGGCTTCACAGATGGGG + Intergenic
1105603438 13:21907878-21907900 GGCCTGGGGTCTCACAGTGGTGG - Intergenic
1107991025 13:45819393-45819415 GGCCTTGGGCTGCACAGTGTTGG + Intronic
1110846799 13:80198827-80198849 GTACTCTGGTTTCAAAGTGGAGG - Intergenic
1112159696 13:96854463-96854485 GGCATCTGGCTTCACAGAAGTGG + Intergenic
1113573839 13:111380774-111380796 GTTCCCAGGCTTCACAGTGGAGG + Intergenic
1113925435 13:113939248-113939270 GGCTTCTGGCATCACCGGGGCGG - Intergenic
1113959478 13:114118634-114118656 TGCCTGTGGCTTAAAAGTGGCGG - Intronic
1114265681 14:21071350-21071372 GGCCGCTCGCTGCAGAGTGGAGG + Intronic
1116307844 14:43281580-43281602 GGCCTTTGGCTTCAGACTGAAGG - Intergenic
1118002113 14:61533018-61533040 GGGCTCTGGGCTCACAGTGCCGG + Intronic
1118238876 14:64037764-64037786 GGCCTCTCACTTCCCAGTAGGGG + Intronic
1118502058 14:66371115-66371137 GGACTCCTGCTTCACAGTGGAGG + Intergenic
1119141964 14:72275459-72275481 GGCCATTGGTTTCACAGTAGGGG + Intronic
1119191574 14:72686205-72686227 GGCAGTTAGCTTCACAGTGGTGG + Intronic
1121036173 14:90705460-90705482 GGCCTCTGGGTTCCCAGGGCAGG + Intronic
1121558166 14:94854285-94854307 GGCCTCTGGCCTCAAAGAGCAGG - Intergenic
1122657948 14:103274278-103274300 GGCCTCTGTCTTCACACAGGAGG + Intergenic
1122904229 14:104794756-104794778 GGCCTCTGGCTGCAGAGCAGGGG + Intronic
1123960588 15:25395538-25395560 GGCTTCTGGCTGCACAGGAGGGG + Intronic
1126497869 15:49312465-49312487 GGCCTTTGGCTTCAGACTGAGGG + Intronic
1126689902 15:51281037-51281059 GGTCTCTGGATGCTCAGTGGGGG - Intronic
1126839137 15:52699239-52699261 TGTCTGTGCCTTCACAGTGGTGG + Intronic
1127009268 15:54604598-54604620 GGATTCTGGCCTCACAGAGGTGG - Intronic
1127726033 15:61751009-61751031 GGCCACTGGACTCACAGTCGGGG + Intergenic
1127981377 15:64037756-64037778 GGCCTCTCACTTGACAGTTGAGG - Intronic
1128261824 15:66238021-66238043 GTCCTGGGGCTTCGCAGTGGTGG + Intronic
1128646838 15:69384177-69384199 GGCCTCTGTTTTCACGGTGGAGG + Intronic
1128767194 15:70258422-70258444 GGCCACTGGCTACTGAGTGGCGG - Intergenic
1131031546 15:89190184-89190206 GGCCTCTGGCTTCTGAATGGTGG - Intronic
1131973121 15:97912546-97912568 GGCCTCAGCCTTCAAAGTGCTGG + Intergenic
1132335106 15:101043217-101043239 GGTCTCTGGCCTCACTGTGCAGG - Intronic
1132568276 16:633022-633044 GGCCGCTGACGTCGCAGTGGAGG - Exonic
1132608653 16:804196-804218 GGCCCCTGACTACACAATGGAGG - Intergenic
1132697439 16:1208195-1208217 GGCTTCTGGTCTCCCAGTGGCGG - Exonic
1133224784 16:4335651-4335673 GGCCTCTGCGATCACAGAGGTGG - Intronic
1135977808 16:27122375-27122397 GGCCTCTGGCTGCAGACTGAAGG - Intergenic
1137291626 16:47055542-47055564 GGCCTCCCGCTTCACAGAGCAGG - Intergenic
1137702498 16:50507039-50507061 GTCCTTTGTCTTCCCAGTGGAGG + Intergenic
1141104263 16:81220299-81220321 TTCCTCTGGCTTAACAGTGGTGG + Intergenic
1142016813 16:87753252-87753274 TGCTTTTGTCTTCACAGTGGTGG - Intronic
1142321448 16:89385807-89385829 GGCCTCTGGCTGCGCAGCGGCGG - Intronic
1143496899 17:7317608-7317630 GGCCACTGACTCCCCAGTGGAGG + Intronic
1143513206 17:7406958-7406980 GGCCTCTGGCTTGGGAGAGGGGG - Intronic
1144739566 17:17574033-17574055 GGCTTCTGGCATCACAGAGCTGG + Intronic
1144955908 17:19018699-19018721 GGGCTCCGGCTTCACAGCTGGGG + Intronic
1146604418 17:34246165-34246187 AGCCTCTGCCTTCACTGGGGAGG + Intergenic
1147768852 17:42854362-42854384 CCCATCTGGCTTCAGAGTGGGGG - Intronic
1150188637 17:63214324-63214346 TGCCTCTGGCTTCAGACTGAGGG - Intronic
1150706160 17:67489257-67489279 GGCCTCTGTCCTCACAGATGTGG + Intronic
1152222700 17:79077794-79077816 GGCCTCTGGCTGCTCAGAGGGGG - Exonic
1152386839 17:79979869-79979891 GGGCTCTGGCTTCCAGGTGGTGG + Intronic
1152602950 17:81274283-81274305 TGCCTCTGGCTTCGCAGCAGAGG - Intronic
1152685088 17:81689989-81690011 GGCCTCTGTCCTCACTGTGGCGG - Intronic
1152902009 17:82947649-82947671 GGCCTCTGGCAGGACAGAGGAGG + Intronic
1157269890 18:46265258-46265280 GGCCTCTGCCCTGACAGTGGGGG - Exonic
1157481210 18:48055040-48055062 GGCTTCTGGCTTCACTGGGCAGG + Intronic
1157509994 18:48264436-48264458 GGGCTCTGGCTTCCCAGAGTAGG - Intronic
1159542567 18:69796751-69796773 TGCAGCTGGCTTCACAGTTGTGG - Intronic
1161659277 19:5536174-5536196 GGCCTTGGGCTTCCCAGAGGAGG + Intergenic
1162231472 19:9270575-9270597 GGCCTCCGGCTCCACAGAGCAGG + Intergenic
1162838271 19:13336039-13336061 GGGCTCTGGCATCCCAGAGGGGG + Intronic
1163403805 19:17110359-17110381 GGCCTCTAGCCTCCCAGTGCAGG + Intronic
1165097582 19:33417994-33418016 GGCTTCTGGCTGGACAGAGGGGG + Intronic
1165899048 19:39160061-39160083 GGCCTGGGCGTTCACAGTGGGGG + Intronic
1166224031 19:41383886-41383908 GGCCTCAGGGTTCACAGTGAGGG - Exonic
1166540094 19:43599362-43599384 GCCCTCTGCCTTCCCAGGGGAGG - Exonic
1166689648 19:44814681-44814703 GACCTATGGCTGCAGAGTGGAGG + Exonic
1167406329 19:49310935-49310957 TACCTGTGGCTTAACAGTGGAGG - Exonic
1167602417 19:50462006-50462028 GGCCTCTGACAGCACAGTTGAGG - Exonic
925449175 2:3953607-3953629 GGCCTTTGGAGTCACAGTGATGG + Intergenic
929934732 2:46286429-46286451 GACCTCTGGCTTCCCCGTGGTGG - Intergenic
930357980 2:50345664-50345686 GGAATCTGGCCTCACAGTGCTGG + Intronic
933253097 2:80050524-80050546 GGGCCCTTGCTTCACAGTGCTGG + Intronic
933801271 2:85961876-85961898 GGCCTCTGGCTCCACAGAGCAGG - Intergenic
936457840 2:112688855-112688877 GGGCTCTGACTACACAGTGGGGG + Intergenic
937097571 2:119245640-119245662 GGGCTCTGGCTTCAAAGTGGTGG + Exonic
937129391 2:119496119-119496141 ACCCTCTGGCTTCTCAGTGGAGG + Intronic
937242684 2:120472525-120472547 AGGCTCTTGCTTCACAGAGGAGG + Intergenic
938580014 2:132637370-132637392 GGCCTCTGGCCTCAACGTGGTGG + Intronic
939843688 2:147219224-147219246 GGTTTCTGCCATCACAGTGGTGG - Intergenic
940112414 2:150169418-150169440 GGCCTTTGGCCTCAGAGTGAGGG - Intergenic
942400770 2:175600632-175600654 GGCCTCTGGTGACACAATGGAGG - Intergenic
944336188 2:198538193-198538215 GGCCCCTGGCTTCCCAGTGCTGG - Intronic
944648407 2:201803861-201803883 CATCTCTGGCTTCCCAGTGGTGG + Intronic
946167151 2:217871312-217871334 GGCCTGTGACTTCAAGGTGGTGG - Intronic
947233863 2:227919945-227919967 GCCCTCTGGCTGGTCAGTGGTGG + Intronic
948568589 2:238901989-238902011 AGCCCCTGGCATCACAGCGGAGG - Intronic
1170572877 20:17642258-17642280 GGCCTCTGGCTGCAGTATGGGGG + Intronic
1172628795 20:36364571-36364593 TGCCTCAGGCTTCCCAGTGTGGG - Intronic
1173555314 20:43961597-43961619 GGCCTCCAGCTGCACTGTGGCGG + Intronic
1173769528 20:45645825-45645847 GGCTTCTCGCTTCCCAGTAGGGG + Intergenic
1175527293 20:59644136-59644158 GGCCTTTGACTTCATAATGGAGG - Intronic
1175538273 20:59730412-59730434 GGGCTCTGGGGTTACAGTGGGGG + Intronic
1176046904 20:63097454-63097476 CGCCGCTGGGTTCACAGGGGAGG + Intergenic
1176097718 20:63351987-63352009 GGCCTCAGGCTTCCCATTGGTGG - Intronic
1177496171 21:21894935-21894957 GTCCTGAGGCTTCACAGAGGAGG + Intergenic
1180076907 21:45467693-45467715 GAACTGTGGCTTCACAGTGGAGG + Intronic
1180093979 21:45546194-45546216 GGCTTCTGGCTTCACAGACAAGG - Intergenic
1180784153 22:18537521-18537543 GGGCTCTGCCTCCATAGTGGGGG - Intergenic
1181127720 22:20711570-20711592 GGGCTCTGCTTCCACAGTGGGGG - Intronic
1181241055 22:21476873-21476895 GGGCTCTGCCTCCATAGTGGGGG - Intergenic
1181488419 22:23246124-23246146 GGCCTCTGCCTTCAAAGGGAAGG - Intronic
1181570406 22:23765139-23765161 GTCCTCAGGCTTCACAGATGTGG + Intronic
1181713307 22:24705418-24705440 GGCCTCTAGCTCCACAGCTGAGG - Intergenic
1183253798 22:36747833-36747855 GGCCTCTGGCATGACACTAGTGG - Intergenic
1183829513 22:40410387-40410409 GGCCACTGGCTTCACATTCTGGG - Exonic
1183969933 22:41469198-41469220 GACCTCTGGGTTCACGGGGGCGG + Intronic
1184235167 22:43179418-43179440 TGCCTGTGGCTGCACGGTGGGGG - Intronic
1184675333 22:46038749-46038771 GGCTTCTGACTTTACAGTCGTGG - Intergenic
949108993 3:235927-235949 GGCCTCTGGCTTCTGGGAGGTGG + Intronic
949751459 3:7356760-7356782 GGCCTTTGGCCTCACACTAGAGG + Intronic
950094717 3:10322110-10322132 GGTCTCTGGCTTCACAAGGTAGG + Intergenic
950137288 3:10590575-10590597 TGCCTCTTTCTTCACATTGGAGG - Intronic
950161609 3:10764761-10764783 CGCCTCTGGCTACAAAGTGTGGG + Intergenic
950283486 3:11726428-11726450 GGGCTCTGGCAGCACAGTTGAGG + Intergenic
950719127 3:14870161-14870183 GCCCTAGGGCTTCACAGTGCGGG - Intronic
954639562 3:52089895-52089917 GGCATCTGGTTCCACACTGGTGG - Intronic
955683980 3:61531548-61531570 GGCATCAGTCTTCACAGTGATGG - Intergenic
956191232 3:66610318-66610340 GGTCTGTGGCCTCCCAGTGGGGG + Intergenic
956608145 3:71094061-71094083 GGCCCCTGGCTTCAAAGTTCAGG - Intronic
957088587 3:75706514-75706536 GGCCCCAGGCCTCACAGAGGAGG + Intergenic
959521760 3:107329263-107329285 GGCCTCTGGTGCCGCAGTGGTGG - Intergenic
963610146 3:147456850-147456872 TGCCTCTGCCATCACACTGGTGG - Intronic
964255166 3:154767005-154767027 GGCCTCTGGCTCCACAGAGCAGG - Intergenic
965141154 3:164836431-164836453 GGCCTTTGGCCTCTCAGTGCTGG + Intergenic
966527219 3:180932449-180932471 TGCCTATGGTTACACAGTGGTGG + Intronic
968130235 3:196188891-196188913 GGGCCCTGGCTTCACAGGGAGGG - Intergenic
968635704 4:1677593-1677615 GGCTTCTGCTTTCACACTGGAGG + Intronic
968929614 4:3571848-3571870 TGCCTCTGCCTTCAAAGTGCTGG + Intergenic
968965906 4:3769014-3769036 GGCCTCTGGCCTAAGAGTGATGG - Intergenic
968982595 4:3858485-3858507 GGCCACTGGCTGCACAGCTGGGG - Intergenic
969091409 4:4696599-4696621 AGCCTCTGGCTGCACATTTGTGG - Intergenic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
970114827 4:12683138-12683160 TACCTCTGTCTTCACAGAGGTGG - Intergenic
977819937 4:101459320-101459342 TGTCTCTGGTTTCAGAGTGGGGG - Intronic
979744820 4:124199084-124199106 GGTCTCTGGCTTCCCCGTGATGG - Intergenic
980876126 4:138664076-138664098 GAAATCTTGCTTCACAGTGGAGG - Intergenic
983221473 4:165047990-165048012 GGCCTCTGCTTTCACTGAGGAGG - Intergenic
986098873 5:4586933-4586955 GACCTCTGTCTCCACATTGGAGG + Intergenic
986447245 5:7832159-7832181 AGCCCCTGGCTTCAGCGTGGAGG - Intronic
986565052 5:9104742-9104764 TGCCTGTGGCTTCACAGAGCGGG - Intronic
986715693 5:10522116-10522138 GGCTTCTGGCAGCACAGAGGCGG - Intergenic
988993338 5:36692349-36692371 GGCCTTCCGCTTCAGAGTGGTGG + Intergenic
989268950 5:39509478-39509500 GGCTGCTGGACTCACAGTGGTGG + Intergenic
992666509 5:79014902-79014924 GGCCTCTGTCCTCAAAGTTGAGG + Intronic
992782331 5:80139641-80139663 GGCCTTTGACTTCACAGTACTGG - Exonic
993980733 5:94540469-94540491 GGTCTCTGCCATCACAATGGTGG + Intronic
997831340 5:137153135-137153157 GGCCCCTGGCCTCACAGAGCAGG - Intronic
998046653 5:138992402-138992424 GGATTTTGGCTTCACAGAGGAGG - Intronic
998137893 5:139684021-139684043 GGCCTCTGGATCCAGAATGGGGG + Intergenic
998176154 5:139903539-139903561 GGTCTCGGGCTTCTCAGAGGCGG - Intronic
998332368 5:141340375-141340397 AGCCTCTGTCTTCTCAGTGACGG + Exonic
998477178 5:142431878-142431900 GGCGTCTGGGGTGACAGTGGTGG + Intergenic
999229127 5:150051335-150051357 GGCCTCTGGCTTTGCCTTGGAGG + Intronic
1000467694 5:161600395-161600417 CTCCAGTGGCTTCACAGTGGTGG - Intronic
1002434410 5:179222038-179222060 GGCCTCTGGGCTCAGAGTGGCGG - Intronic
1002714435 5:181217629-181217651 GGCTTTTGGGTTCGCAGTGGCGG - Intergenic
1003641931 6:7883052-7883074 GGCCACTGGGTTCCCAGTGGTGG - Exonic
1005589797 6:27311880-27311902 GGCCTCTCCCTTCAGACTGGTGG - Exonic
1006501572 6:34462654-34462676 GGACTCTGCCTTCCCAGGGGCGG - Intergenic
1007470008 6:42083695-42083717 GGACTCTGCCATCACAGAGGAGG + Intronic
1011046180 6:83085899-83085921 TGTCTCTGGCTTCTCTGTGGAGG + Intronic
1011712767 6:90071369-90071391 GGGCTATGGCATCACAGAGGAGG + Intronic
1017538315 6:155372457-155372479 GGCATCTGTATTTACAGTGGTGG - Intergenic
1017950133 6:159129233-159129255 GGCCTCGAGCTGCAAAGTGGTGG + Intergenic
1019153595 6:170024367-170024389 GCCCTGTGACTTCACGGTGGAGG + Intergenic
1019153614 6:170024438-170024460 GCCCTGTGACTTCACGGTGGAGG + Intergenic
1019621885 7:1996409-1996431 AGCCTCTGGCTTCTCATGGGAGG - Intronic
1019648925 7:2145897-2145919 GGCTTCTGGCTTCACGGACGTGG + Intronic
1020232545 7:6330916-6330938 GGCCTCTGGCTTCACAGTGGCGG - Exonic
1022519481 7:30996661-30996683 GGGCTCAGGCTTCAAAGTGGAGG + Intergenic
1022529103 7:31056179-31056201 GGGCTAGGGCTTCTCAGTGGAGG + Intronic
1023706944 7:42950926-42950948 TGCTTCTTGCTTCTCAGTGGTGG - Intergenic
1026273607 7:68857745-68857767 GCCATCTGGGTGCACAGTGGGGG + Intergenic
1026625321 7:71987144-71987166 GGCCTGTGACTTCAGTGTGGAGG - Intronic
1026931190 7:74223874-74223896 GCCTTCAGGCTTCAAAGTGGGGG - Intronic
1029518466 7:101043658-101043680 AGCCTCAGGGTTCACAGTCGTGG - Exonic
1030131744 7:106207410-106207432 GTCCCCTGGGTTCACAGGGGAGG - Intergenic
1032796914 7:135285002-135285024 GGGCTCAGGCATCCCAGTGGGGG + Intergenic
1033621104 7:143062693-143062715 TGCCTCTCACCTCACAGTGGTGG - Intergenic
1033633170 7:143181511-143181533 AGGGTCTGGCTTCACAGTGTAGG - Intergenic
1035706842 8:1682195-1682217 GGCCTCTGTCTTCGCAGCTGAGG - Intronic
1042435505 8:68760101-68760123 GGCCTGTGGCTTGATAGTGAAGG + Intronic
1043812932 8:84765180-84765202 GAGCTCTGGCATCACAGGGGAGG - Intronic
1044702568 8:94977731-94977753 GGCCTTTGGCTTCAGACTGAGGG + Intronic
1044909971 8:97046654-97046676 TGCCTCTGATTTCACAGGGGAGG - Intronic
1045294286 8:100860352-100860374 GGTCTCCGGCTCCACAGTGGAGG - Intergenic
1047510846 8:125514004-125514026 GGCCCCCGGCTGCAGAGTGGGGG - Intergenic
1047746853 8:127851593-127851615 AGTCTCTGACCTCACAGTGGAGG - Intergenic
1048409022 8:134152298-134152320 TGTCTCTGGCTTCACAGTGGAGG - Intergenic
1049692503 8:143968337-143968359 GGCCTCAGCCTCCACAGTGCTGG - Intronic
1050594089 9:7188615-7188637 GGCCTCATGGTACACAGTGGAGG - Intergenic
1050601523 9:7257824-7257846 TGCCTCTGAGTTCACACTGGAGG + Intergenic
1051927619 9:22348135-22348157 AGCCTCAGCCTTCATAGTGGTGG - Intergenic
1053320345 9:37092846-37092868 GGCCTGTGGTTTCACAGTGGTGG - Intergenic
1053493250 9:38527298-38527320 GGCCTCTCGCTTCCCAGTGGCGG + Intergenic
1053533747 9:38905839-38905861 GGCCTCTGGTGTTGCAGTGGTGG - Intergenic
1054205973 9:62130268-62130290 GGCCTCTGGTGTTGCAGTGGTGG - Intergenic
1054460666 9:65460623-65460645 TGCCTCTGCCTTCAAAGTGCTGG - Intergenic
1054632387 9:67458102-67458124 GGCCTCTGGTGTTGCAGTGGTGG + Intergenic
1056850612 9:90080683-90080705 GGCCTTCGGCTTCACTGTTGTGG - Intergenic
1057217312 9:93236217-93236239 GGCCCCTGGGTTCACTGTGGAGG + Intronic
1057560724 9:96126116-96126138 GGGCTATGGCTTCACATTCGTGG + Intergenic
1057673938 9:97121876-97121898 GGCCTCTCGCTTCCCAGTGGCGG + Intergenic
1058263747 9:102872288-102872310 GCCTCCTGCCTTCACAGTGGGGG - Intergenic
1059305583 9:113350644-113350666 GCCCTCAGGCTTCACAGCAGGGG - Intronic
1059708152 9:116842828-116842850 GGCCTGAGACTTCAGAGTGGAGG + Intronic
1060783809 9:126433358-126433380 AACCTCTGCCTTCATAGTGGGGG + Intronic
1061845188 9:133384033-133384055 GGCTGCTGGCTTCACAGCTGAGG - Intronic
1061881738 9:133572315-133572337 GGCCTGGGGCTTCCCAGGGGAGG + Intronic
1062315358 9:135964486-135964508 GGCCACGGGCTTTACAGCGGGGG + Intergenic
1062464211 9:136674023-136674045 GGCCTCGGGCTTCCCAGGGAGGG - Intronic
1062576517 9:137211430-137211452 GGGCCCTGGCTTTTCAGTGGTGG + Intronic
1186317131 X:8383301-8383323 GGACTGTGGATTCCCAGTGGGGG - Intergenic
1189544049 X:42023340-42023362 GGCCTATGGCTTCACAGAAGAGG - Intergenic
1190044787 X:47102932-47102954 GGCTTCTTTCTTCACTGTGGAGG - Intergenic
1191678277 X:63814797-63814819 GACCTTTGGCCTCTCAGTGGAGG - Intergenic
1194400738 X:93435734-93435756 TCCCTCTACCTTCACAGTGGTGG - Intergenic
1195175241 X:102308493-102308515 GACCTCTGGCTTATCAGTGCTGG - Intronic
1195183624 X:102378600-102378622 GACCTCTGGCTTATCAGTGCTGG + Intronic
1195267184 X:103193850-103193872 GGCCTCTGGCTTAACACAGGAGG - Intergenic
1195694048 X:107653734-107653756 GGCTTCTGTCTTGGCAGTGGTGG + Intergenic
1196883785 X:120223923-120223945 GGCCTCTGGCTCCACAGAGCGGG - Intergenic
1199583490 X:149385748-149385770 GGCCTTTGGCTTCAGACTGGAGG + Intergenic
1200230954 X:154443750-154443772 GGCCTCTGGCTTGAAAGGAGAGG + Intergenic
1200764057 Y:7065587-7065609 GGCCTCAGACTTAACAGTGGTGG - Intronic
1200884070 Y:8251935-8251957 GGCCTCAGGCTTCAGAGGGCGGG + Intergenic
1200948458 Y:8868685-8868707 TCCCTCTACCTTCACAGTGGTGG - Intergenic
1202030029 Y:20561743-20561765 GGCCTCTAGATCCACAGAGGTGG - Intergenic