ID: 1020234719

View in Genome Browser
Species Human (GRCh38)
Location 7:6346893-6346915
Sequence TTGGGGAGTTTACAGTTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020234719_1020234734 28 Left 1020234719 7:6346893-6346915 CCGTCCAACTGTAAACTCCCCAA 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1020234734 7:6346944-6346966 ATGCAAATGGAATGCAAGAGGGG 0: 1
1: 0
2: 5
3: 52
4: 339
1020234719_1020234727 4 Left 1020234719 7:6346893-6346915 CCGTCCAACTGTAAACTCCCCAA 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1020234727 7:6346920-6346942 GGGTCCCTCCTTCAGCACAGAGG No data
1020234719_1020234731 15 Left 1020234719 7:6346893-6346915 CCGTCCAACTGTAAACTCCCCAA 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1020234731 7:6346931-6346953 TCAGCACAGAGGTATGCAAATGG 0: 1
1: 0
2: 1
3: 14
4: 232
1020234719_1020234732 26 Left 1020234719 7:6346893-6346915 CCGTCCAACTGTAAACTCCCCAA 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1020234732 7:6346942-6346964 GTATGCAAATGGAATGCAAGAGG 0: 1
1: 0
2: 1
3: 14
4: 184
1020234719_1020234733 27 Left 1020234719 7:6346893-6346915 CCGTCCAACTGTAAACTCCCCAA 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1020234733 7:6346943-6346965 TATGCAAATGGAATGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020234719 Original CRISPR TTGGGGAGTTTACAGTTGGA CGG (reversed) Intronic
900640137 1:3684575-3684597 TGGGGGAGTGTAGAGGTGGAGGG + Intronic
902120577 1:14161767-14161789 TTGGGGGGTTTGGAGATGGAAGG - Intergenic
902282162 1:15382625-15382647 CTGAGGAGTATACAGGTGGATGG + Intronic
903352335 1:22725159-22725181 TTGGGTAGTGTACAGTTAGACGG + Intronic
903374522 1:22857512-22857534 CTGGAGAGCTTACAGTAGGATGG + Intronic
904595119 1:31639364-31639386 CTGGGGAGCTTACTGTTGGGTGG - Intronic
904766516 1:32852899-32852921 ATGGGGAGATTACTCTTGGAGGG - Intronic
905163120 1:36054516-36054538 TTTGGGAGGTTAAAGTGGGAGGG - Intronic
906307526 1:44729299-44729321 TCGTGGAGTTTACAGTCAGATGG - Intergenic
910039025 1:82825014-82825036 ATGGGGAGTTCCCAGGTGGAGGG + Intergenic
914978806 1:152393600-152393622 TTTGGGAGTTCACAGGTAGAGGG + Intergenic
917658060 1:177147415-177147437 TTAAGGAGCTTACAGTTGCAGGG + Intronic
920067587 1:203279999-203280021 TTGGGTTGTTGGCAGTTGGAAGG - Intergenic
920077195 1:203346060-203346082 TTTGGGAGTTGACAGTCGGGTGG - Intronic
922236335 1:223725511-223725533 TTGGGGACAGTACAGCTGGAGGG + Intronic
923960330 1:239074800-239074822 TAGGGGAGTTTAGAGCTGTAAGG + Intergenic
924559171 1:245143410-245143432 TGGGGGAGTGGACAGATGGACGG - Intergenic
924595127 1:245438623-245438645 TTGGGTAGTTTACATTTTGGGGG - Intronic
1063643073 10:7851017-7851039 TTGTGGAGTTTACACTTCCATGG + Intronic
1063783061 10:9349226-9349248 TTGGGGGTTTTACAGTTGTGTGG - Intergenic
1064586208 10:16841952-16841974 TGGGAGAGTTTACATCTGGAAGG - Intronic
1069323049 10:67197484-67197506 TTGAGAATTTTACAGTTGCAAGG - Intronic
1070377844 10:75851423-75851445 TTGATGAGTTTTGAGTTGGAAGG - Intronic
1070636675 10:78134254-78134276 TTGAAGAGGTCACAGTTGGATGG + Intergenic
1070997930 10:80802687-80802709 TTGGGGACTTTACAGTCACATGG + Intergenic
1072040715 10:91603678-91603700 CTGGGGATTTTCCAGTTAGAGGG - Intergenic
1075042316 10:119118009-119118031 TTGGGGATTTTGTTGTTGGAAGG - Intronic
1077053727 11:579785-579807 TTTGGCAGTTGACAGTTGGATGG + Intronic
1078614174 11:12849369-12849391 TTGCGGAGTTTAGAGATGGTGGG - Intronic
1079531715 11:21462403-21462425 TTTGGGAGTTTAAGGTAGGATGG + Intronic
1083547470 11:63559559-63559581 TTGGAGAATTTAAAGCTGGAGGG - Intronic
1084116483 11:67045651-67045673 TTGGGGAGTTTGGAGTCGGTGGG + Intronic
1084662131 11:70552170-70552192 TAGGTGAGGTGACAGTTGGAAGG + Intronic
1084912341 11:72400931-72400953 TTGGGGAGTTTGCAGTCTAATGG - Intronic
1086827114 11:91512401-91512423 TTGTCCATTTTACAGTTGGAGGG - Intergenic
1086914340 11:92511570-92511592 GTGGGGAGCTCACAGTAGGATGG + Intronic
1086924688 11:92627497-92627519 TTTTGGAATTTATAGTTGGATGG + Intronic
1090199027 11:124840555-124840577 ACGGGCAATTTACAGTTGGATGG + Intergenic
1090752713 11:129761420-129761442 TTGGGTAGTTTCCAGTTTGAGGG + Intergenic
1090860138 11:130645748-130645770 TCTAGGATTTTACAGTTGGAGGG - Intergenic
1091241583 11:134056046-134056068 CAGGGGAGTATAAAGTTGGATGG + Intergenic
1098937282 12:76494882-76494904 TTGGGGAGTTAACATATTGATGG + Intronic
1100200899 12:92296909-92296931 TTGAGGAGTTTAAAGTTCAATGG - Intergenic
1104416321 12:128599017-128599039 GTGGGCAGTTGACAGTGGGAAGG + Intronic
1108427045 13:50313097-50313119 TTGGGGAGTGTGGGGTTGGATGG - Intronic
1109454855 13:62571825-62571847 TTAAGGAGATTACAGTTGTAAGG - Intergenic
1110184303 13:72655563-72655585 TGGATGAGTTTACAGTTGTAAGG - Intergenic
1111861262 13:93709828-93709850 TTGAGTAGTTTACACTTGGCTGG + Intronic
1112000911 13:95208996-95209018 TTGGGGAGCTTACAATTTAATGG + Intronic
1116140179 14:40983392-40983414 GTGGGGAGTTGAGAGTGGGAAGG - Intergenic
1116425666 14:44787557-44787579 TTAAGGAGCTTACAGTTTGAAGG + Intergenic
1116966574 14:51021503-51021525 TTATGGAGTTTACAGTTCAATGG - Intronic
1118289716 14:64508371-64508393 GTGGGGAGTTAGCAGATGGAAGG + Intronic
1120092025 14:80343003-80343025 TTGTGGAGGTTACAGTTGAGTGG - Intronic
1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG + Intronic
1202904595 14_GL000194v1_random:60869-60891 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1124460112 15:29882143-29882165 TTGGGGAATTTAAGGTTGGCTGG - Intronic
1126308505 15:47288798-47288820 CTGTGGAGTGTACAGGTGGAAGG - Intronic
1126695190 15:51320103-51320125 ATGGGGAGATTTGAGTTGGAAGG - Intronic
1127641920 15:60924038-60924060 TTGGGAAGTTTTCAGTGGGCTGG - Intronic
1127925788 15:63539654-63539676 TTGGGGAGTATACACTATGATGG + Intronic
1128117711 15:65121510-65121532 TTTGGGAGTGCACACTTGGATGG + Intronic
1128609137 15:69059899-69059921 TTGGGGAGTTTGCAGCTTCATGG - Intronic
1129128751 15:73470754-73470776 TGGGGGAGTTTTCAGATGGATGG + Intronic
1130051199 15:80485459-80485481 TTGTGGAGTTTACAGTTCAGTGG + Intronic
1132823584 16:1890873-1890895 TTGAGGAGCTCACAATTGGAAGG + Intergenic
1132860410 16:2068435-2068457 CTGGGGAGTTAAAAGTTAGATGG - Intronic
1138605192 16:58084045-58084067 CTGGGGAGTTGACACTTGGTGGG - Intergenic
1138869085 16:60859212-60859234 TTGGGGAAGTTACAGTTGGAAGG - Intergenic
1140573640 16:76138042-76138064 TTGAGGATTTTAAAGTTGGGGGG + Intergenic
1141853792 16:86667087-86667109 TTGGGCTGTTTAGAGTGGGAAGG - Intergenic
1142388054 16:89779490-89779512 TTGGGGAGCTTGCACTGGGAGGG - Intronic
1142717400 17:1754670-1754692 TTGGGGAGTTTAGGGTGGGGGGG + Exonic
1142744717 17:1950130-1950152 TTTGGGAGGTTGCATTTGGAGGG + Intronic
1147487688 17:40833509-40833531 TTGGAGAGTTTTGAGATGGAAGG - Intronic
1148448615 17:47757908-47757930 TTGTGGAGTTCAAAGTGGGAGGG + Intergenic
1150562664 17:66307406-66307428 TTAGGGAGTTTAAAGATGTAAGG + Intronic
1151358461 17:73573944-73573966 TCGGGGAGGTGACATTTGGAAGG - Intronic
1152107406 17:78338758-78338780 TTGGGGGGCTTCCAGTTGGGGGG - Intergenic
1156458075 18:37305921-37305943 TCAGGGTGTTTACAGTTGGTTGG - Intronic
1158748906 18:60235783-60235805 TTAGGGAGTTTACATTTCCATGG - Intergenic
1164438897 19:28256596-28256618 GTGGGGAGTTTCCAGGTGGCTGG - Intergenic
1165117163 19:33535518-33535540 TTGGGGAGTTTCCAGTTTGGGGG - Intergenic
1166030629 19:40123952-40123974 TTGGGAAATATACAATTGGATGG + Intergenic
1166302085 19:41916971-41916993 TTGGGAAGTTCACAGATGGAGGG - Intronic
925530137 2:4850319-4850341 TTGTGGGGCTGACAGTTGGAGGG - Intergenic
925731695 2:6923581-6923603 TTGGCAATTTTACAGCTGGAAGG - Intronic
926759786 2:16268255-16268277 TAGGGGATTTTACTTTTGGAAGG + Intergenic
930912347 2:56644283-56644305 TTGTGGAGCTTACAGTTGAAAGG - Intergenic
932459788 2:71874805-71874827 TTTGGGAGCTTACAGGTTGAGGG + Intergenic
934502046 2:94869526-94869548 TTTGGGAGTTTGCAGCTGGCAGG + Intergenic
934765619 2:96878553-96878575 GTGGGGAGTGTGCAGGTGGAGGG - Intronic
935612431 2:105038773-105038795 GTGGGGAGTCAACAGCTGGATGG + Intronic
936963883 2:118106498-118106520 TTGGAGGGGTTACAGTTGGTAGG + Intronic
940203630 2:151178171-151178193 TTTATGACTTTACAGTTGGACGG - Intergenic
940514970 2:154671755-154671777 ATGGGGAGATTTCAGTTTGATGG + Intergenic
942310326 2:174650451-174650473 TTGGGTAATTTACAGTTATACGG + Intronic
942315720 2:174694733-174694755 TTGGGGAGTTTATAGTTTAGTGG - Intergenic
943160055 2:184236006-184236028 TTGGGGACTTTTAAGATGGATGG - Intergenic
944115719 2:196184311-196184333 TTGGGGAGTTTACAATGTCATGG - Intergenic
944846677 2:203675563-203675585 TTGTGGAGTGTACAGTCTGATGG + Intergenic
945381164 2:209142593-209142615 TTGTGAATTTTACAGTTTGACGG - Intergenic
947871673 2:233442120-233442142 TTGGGGAGTGTGCAGTTTGGTGG + Intronic
1169417124 20:5426754-5426776 TCTAGGAGTTCACAGTTGGATGG - Intergenic
1174505319 20:51014010-51014032 TGGGGGAGTTTTCTGCTGGAGGG - Intronic
1176623965 21:9075636-9075658 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1177802740 21:25843918-25843940 TTTGGGAGCTTACAGCTGAACGG + Intergenic
1178340667 21:31783506-31783528 GAGGGGATTTTACAGTTGGAGGG - Intergenic
1181888585 22:26041270-26041292 TTTGGGAGGCTAAAGTTGGAGGG + Intergenic
1182678043 22:32055532-32055554 TTCCTGAGTTTACAGTGGGATGG + Intronic
1182936423 22:34227020-34227042 TAGGGGAGTTCACTGTTGCAGGG - Intergenic
1183947639 22:41335756-41335778 TGGGGGAGTGTACAGTTCCAGGG + Intronic
1184087318 22:42272657-42272679 TGGGGAAGTTTCCAGGTGGAGGG - Intronic
1184938961 22:47746915-47746937 TTGGCGAGTTTCAAGATGGAAGG + Intergenic
950635695 3:14312750-14312772 AAGGGAAGTTTACATTTGGACGG - Intergenic
951292553 3:20891084-20891106 TTGGGGAGTTTACATTTCAGTGG + Intergenic
952134999 3:30408604-30408626 TTGGAAAGTTTACACTTGGTGGG - Intergenic
954359283 3:50110479-50110501 TGGGGCTGTTGACAGTTGGAAGG + Intronic
954384663 3:50237757-50237779 TTGGGGGTTTTAGAGTTGGGGGG + Intronic
956176419 3:66477481-66477503 TTGGGGATTGTCCATTTGGAGGG - Intronic
956628025 3:71286256-71286278 TTGGGGATTTTAGAATTAGATGG + Intronic
960359889 3:116698348-116698370 TTGAGGAGCTTACAATTGAATGG + Intronic
962783215 3:138740964-138740986 TAGGGGAATTTACTGTTGAAAGG - Intronic
963831639 3:150015173-150015195 TTGGGAAGTTTAAAATTAGATGG - Intronic
966457554 3:180135063-180135085 TTGTGGACTATACAGGTGGAAGG - Intergenic
967734921 3:192941948-192941970 TATGGGAGTTTGGAGTTGGAGGG + Intergenic
967816390 3:193802531-193802553 TTGAGGAATTTACACTGGGAAGG - Intergenic
969377907 4:6775310-6775332 TTGGAGAGCCCACAGTTGGAGGG + Intergenic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
973678333 4:53288392-53288414 TTGGGGACTTTATAGTTTCATGG - Intronic
975593246 4:76020963-76020985 TTCAGGAGATTACAGTTGGAAGG + Intronic
976799586 4:88973844-88973866 TTGTGAAGTTTACAGTTGAGGGG - Intronic
980593262 4:134919994-134920016 TTGGGGAGTATGGAGTTGCAAGG - Intergenic
982285374 4:153728494-153728516 TAGGGAAGCTTACAGTTTGATGG - Intronic
983746025 4:171201678-171201700 TTGGGGAGGTTACTGTTAGCTGG - Intergenic
984370026 4:178851579-178851601 TTTGGAATTTTAGAGTTGGAAGG - Intergenic
984988039 4:185350537-185350559 TTGGGAACTTTCCAGTTTGAGGG + Intronic
988599113 5:32623024-32623046 TTGGGGAGTTTTGAGTTGTTTGG + Intergenic
990675826 5:58183605-58183627 TTGGGGAGCTCACAGTTTAATGG + Intergenic
992003019 5:72453476-72453498 TTTGGGAGTTGACAGAGGGATGG - Intronic
992099307 5:73390856-73390878 TTTGGGAGTACAGAGTTGGAGGG + Intergenic
993510324 5:88763235-88763257 TTGGGGAATTTATAATTGGTGGG + Intronic
994338084 5:98592878-98592900 TTGGGGGGTATACATATGGAAGG - Intergenic
995736867 5:115310885-115310907 TTGTGGAGTTTGCATTTGAATGG - Intergenic
996004062 5:118400037-118400059 ATGGGGAGCTTGCAGTTGAAAGG + Intergenic
996509321 5:124301131-124301153 TTGGGAAATTTACATTTTGATGG + Intergenic
999362373 5:150997035-150997057 ATGCGGAGTTTACTGTTGAATGG - Intergenic
1000358008 5:160419258-160419280 GTGGGGAGTTTCAAGTTGGGCGG + Exonic
1003163353 6:3654980-3655002 TTCTGGAGTCCACAGTTGGAAGG + Intergenic
1003682427 6:8269271-8269293 TTGGGCAGGGTTCAGTTGGAAGG + Intergenic
1005408938 6:25521874-25521896 TTAGGGAGTTTAGAGCTGTAGGG + Intronic
1007290159 6:40779656-40779678 TTGGGGAGTATTCAGTTAGCTGG + Intergenic
1010033867 6:71298896-71298918 TTGAGTAGTTTACAGTAGGCAGG + Intronic
1011035413 6:82968713-82968735 TTGGGGTTTTTAAAGTTTGATGG + Intronic
1011535575 6:88372408-88372430 TTGGGGAGTTGAGAGTAGGAAGG + Intergenic
1011814623 6:91174124-91174146 GAGAGGAGTTTACAGGTGGAAGG - Intergenic
1017409974 6:154157546-154157568 TAAAGGAGTTTACAGTTGAAAGG + Intronic
1019328156 7:449526-449548 CTGGGGAGCTCACAGTAGGAGGG - Intergenic
1019917447 7:4142998-4143020 TTGGGGAATTTACATTTTAAGGG + Intronic
1020234719 7:6346893-6346915 TTGGGGAGTTTACAGTTGGACGG - Intronic
1020979434 7:15049579-15049601 TTGGCAAGTTTCCAGTTTGAGGG - Intergenic
1021791156 7:24207209-24207231 TTGGGCTGTTTACAGTTCGGGGG - Intergenic
1022975620 7:35553376-35553398 GTGGGGAGTTTTCAGTAGGCAGG - Intergenic
1023126213 7:36957000-36957022 TTGGGGAGATCACAGTTTGTGGG - Intronic
1024820428 7:53322886-53322908 TTGGTGAGTTTACAATTGTTTGG + Intergenic
1032298659 7:130667619-130667641 TTGGGAAGTGAACACTTGGATGG + Intronic
1035365412 7:158346268-158346290 ATGGGGAGATAACAGGTGGAGGG - Intronic
1035370359 7:158375912-158375934 TGGGGGATTTTACTGCTGGATGG - Intronic
1037287242 8:17314452-17314474 TCTGGGGGTTTACAGTTGGAAGG - Intronic
1038760708 8:30382972-30382994 TTAGGGAGTTTAAAGTGGTATGG - Intergenic
1039831690 8:41220485-41220507 TTAGGGTGTTTTCAGTTGTATGG + Intergenic
1040450378 8:47540091-47540113 TTGTGTAGTTCACAGTTTGAGGG + Intronic
1041707430 8:60861133-60861155 TTGCAGAGTTTAGAGTTGGAAGG + Intronic
1044912346 8:97073695-97073717 TTGTGGAGTTTACATTGTGATGG + Intronic
1045657311 8:104400136-104400158 ATGGGGAGCTCACAGATGGAAGG - Intronic
1048494867 8:134926628-134926650 TCCAGGAGTTTGCAGTTGGAAGG - Intergenic
1050314763 9:4390175-4390197 TTGTGGAGAATAAAGTTGGAGGG + Intergenic
1052894277 9:33732683-33732705 TTGGGTAGTTTGCAGTTTGAGGG + Intergenic
1053008308 9:34618957-34618979 TTGGGGAGTTTCAAGTCTGATGG + Intronic
1053158386 9:35795975-35795997 TTTTGGAGTTTACATTTGGTAGG + Intronic
1058153750 9:101488918-101488940 TTAGGGAGCTTACATTTGGGTGG + Intronic
1060254594 9:122015961-122015983 TTGTGGAACTTACAGTAGGAGGG + Intronic
1061229444 9:129305826-129305848 TTGGGCAGTTTCCAGTCTGAGGG - Intergenic
1203747148 Un_GL000218v1:46064-46086 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1203562958 Un_KI270744v1:73416-73438 TTTGGGAGTTTGCAGCTGGCAGG + Intergenic
1185690336 X:2149687-2149709 TTGGGCAGAGTACAGTTGAAAGG + Intergenic
1185895313 X:3853419-3853441 TTGGGGGGTTGATGGTTGGAGGG - Intergenic
1185900430 X:3891843-3891865 TTGGGGGGTTGATGGTTGGAGGG - Intergenic
1185905546 X:3930274-3930296 TTGGGGGGTTGATGGTTGGAGGG - Intergenic
1186399945 X:9248508-9248530 CTTGGGAGTATTCAGTTGGATGG - Intergenic
1186779543 X:12899078-12899100 TTTGGGATTTTAAAGCTGGAGGG + Intergenic
1189400057 X:40659167-40659189 TTGAGGAGGTTAGAGTTGGTGGG - Intronic
1189865585 X:45323759-45323781 TTGGGGAGTTTTCAGCTGGATGG + Intergenic
1191921130 X:66258259-66258281 TGGAGGAGTTCACAGGTGGAAGG + Intronic
1192614325 X:72602710-72602732 TTTGTGAGTTTAAAGTTGAAGGG + Intronic
1194577609 X:95632926-95632948 TTCGTGAATTTACAGTAGGATGG - Intergenic
1196672190 X:118380669-118380691 TTGGTGATTTTACAGTCTGATGG + Intronic
1199872318 X:151911208-151911230 TTGGGGCGGTGTCAGTTGGAGGG + Intergenic