ID: 1020235093

View in Genome Browser
Species Human (GRCh38)
Location 7:6348991-6349013
Sequence GCGGGGCCTGTGGGCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 379}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020235093_1020235106 14 Left 1020235093 7:6348991-6349013 CCTGCGCGGCCCACAGGCCCCGC 0: 1
1: 0
2: 3
3: 29
4: 379
Right 1020235106 7:6349028-6349050 TTGCCACCTTTCTTTTTGGCAGG 0: 1
1: 0
2: 1
3: 15
4: 219
1020235093_1020235103 10 Left 1020235093 7:6348991-6349013 CCTGCGCGGCCCACAGGCCCCGC 0: 1
1: 0
2: 3
3: 29
4: 379
Right 1020235103 7:6349024-6349046 GCCCTTGCCACCTTTCTTTTTGG 0: 1
1: 0
2: 1
3: 16
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020235093 Original CRISPR GCGGGGCCTGTGGGCCGCGC AGG (reversed) Intergenic
900096003 1:940362-940384 GCGGGGGCGCTGGGCCCCGCTGG + Intronic
900119108 1:1041047-1041069 GCGGGGCCTGCGGGGCCCGGCGG + Intronic
900126787 1:1072292-1072314 GCTCAGCCTGTGGGCCGCCCCGG - Exonic
900187535 1:1339412-1339434 GCGGGGTCGATGGGCCGCACCGG + Exonic
900226404 1:1535349-1535371 GCGGCACCTGTGAGCCGCACGGG - Exonic
900264140 1:1749020-1749042 GAGGAGCCTGTGGGCCGGGGGGG - Intergenic
900527883 1:3137995-3138017 GAGGGGCCTGTGTGCAGAGCTGG + Intronic
900796617 1:4712163-4712185 CCGGGGCCTGTGGGCCCGTCTGG - Exonic
901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG + Intergenic
901455703 1:9361649-9361671 ACGGGGCCTGTGGCCCCAGCAGG - Intronic
901536174 1:9884104-9884126 GCTGGGCCTGTAGGCAGAGCCGG + Intronic
901540194 1:9910398-9910420 GCGGGGCCTGCGGGCGGGGCGGG + Intergenic
902214243 1:14924455-14924477 GCGGGTCCCGGGGGCCGCGCGGG - Intronic
902636070 1:17735879-17735901 GCGGGGGCTGTGGGACCCGTGGG - Intergenic
902803939 1:18849282-18849304 GCGGGGCCTGGGGCCCTTGCTGG - Exonic
902870733 1:19312262-19312284 GCGGGGCCTGCGGTTCCCGCGGG + Intergenic
903218163 1:21854532-21854554 GCGGGGCCTGTACGCTGGGCGGG - Intronic
903883723 1:26529642-26529664 GCGGGGGCGGGGGTCCGCGCTGG + Intergenic
903925226 1:26826913-26826935 GCGGGGGCGGCGGGCGGCGCGGG - Exonic
905448338 1:38042093-38042115 GCTGAGGCTCTGGGCCGCGCAGG + Intergenic
905789786 1:40783947-40783969 GCGGGGGCTAGGGGCCGGGCCGG - Intergenic
906525259 1:46489888-46489910 GCGGGGCTGGCGGGCCGAGCCGG + Intergenic
907136192 1:52141951-52141973 GCGCGGCCTGGGGGCGGCGAGGG - Intergenic
907158992 1:52357840-52357862 GAAGGGACTGTGGGCCGTGCAGG + Exonic
908534869 1:65067556-65067578 GCGGGGGCGGCGGGGCGCGCGGG - Intergenic
912337682 1:108877382-108877404 GCGGGACCTGTGGGCGCTGCGGG + Intronic
913498551 1:119450043-119450065 GGGAGGCCTGTGGGGGGCGCAGG - Intergenic
914244386 1:145874911-145874933 GCGGGGGCTGTGGACAGCACAGG - Exonic
915246297 1:154558478-154558500 GGGGGGCCAGGGGGCGGCGCCGG - Exonic
915341255 1:155178043-155178065 GCGGGGGCTGGGGGCTGTGCTGG + Exonic
916179179 1:162069645-162069667 GCGGGGCCTCTGAGCCCGGCGGG + Intergenic
919802879 1:201364226-201364248 GAGGGGCCTGGGGGCCCAGCAGG + Intronic
921039506 1:211416578-211416600 CCGGCGCCTGCGGCCCGCGCGGG - Intergenic
922315046 1:224434602-224434624 GCGCGGCCCGGGGGTCGCGCCGG + Intronic
922518221 1:226223802-226223824 CCGGGGCCCGCGGGCGGCGCAGG - Exonic
922750101 1:228066235-228066257 GTGGGGCCTGTGGGGGGCGGTGG - Intergenic
922790285 1:228307416-228307438 GCGGAGCCAGGGGGCCACGCGGG + Exonic
923490291 1:234478461-234478483 GCGGGCCGTGTGGGGCGGGCTGG - Exonic
1062843583 10:689117-689139 GTGGGGCCTGGGCGCCGCGCGGG - Intronic
1064011956 10:11742630-11742652 GCTGGGCCCAGGGGCCGCGCCGG - Exonic
1064060031 10:12129608-12129630 GCTGGGCCGGTCGGGCGCGCGGG + Intergenic
1064418287 10:15168835-15168857 GCGGGGCCGGCGGGCAGGGCGGG - Intergenic
1066685382 10:37976533-37976555 GCGGGGCCTGGGCCCGGCGCGGG - Exonic
1067037862 10:42932884-42932906 TCGGGGGCTGTGGGCGGGGCGGG + Intergenic
1069661617 10:70127052-70127074 GCTGGGCCTGTGGGCCCTCCTGG - Intronic
1070147521 10:73785778-73785800 CCGGGGCCTGAGGGGCGAGCCGG - Exonic
1070162530 10:73874627-73874649 GCGGGGCCTGGGGGCGGGGCGGG - Intergenic
1071291908 10:84194766-84194788 GCGCTGCCGGTGGGCCGCCCTGG + Exonic
1071291924 10:84194818-84194840 GAGTGGCCGCTGGGCCGCGCTGG + Intronic
1071544916 10:86521809-86521831 GCGGGGTCGGGCGGCCGCGCGGG - Exonic
1071618197 10:87095026-87095048 GCGGGGCGTCGGGGGCGCGCAGG + Intronic
1072654219 10:97319375-97319397 GCGGGCGCGGTGGGCCGCGGCGG - Exonic
1072731453 10:97849852-97849874 GCCGAGCCTGTGGCCCGGGCGGG + Intergenic
1073452264 10:103616951-103616973 CCGGGGCCTCTGTGCCCCGCTGG + Intronic
1075031865 10:119029527-119029549 GCGGGGCGCGGGAGCCGCGCGGG + Intergenic
1075375435 10:121974846-121974868 GCGGCGCCTCCGGGCGGCGCGGG - Intronic
1075782090 10:125023612-125023634 CCGGGGCTGGTGGGCCGCACTGG + Intronic
1076183845 10:128431402-128431424 TGGGGGCCTGTGGGCCCTGCTGG + Intergenic
1076316896 10:129548673-129548695 GCTTTGCCTGTGGGCCGTGCAGG + Intronic
1076805990 10:132858944-132858966 GAGGGTCCTGTGGACCCCGCGGG + Intronic
1076839860 10:133040627-133040649 GGGGGGGCTGTGGGCGGGGCAGG + Intergenic
1076905270 10:133358040-133358062 GCGGGGCTTGGGGGCCGGGGCGG + Intergenic
1076991830 11:279683-279705 GCGGGGGCCGGGGACCGCGCCGG - Intronic
1077018507 11:407263-407285 GCGGGGCCTGCGGGGTGGGCGGG + Intronic
1077027993 11:450258-450280 GTGGGGCTTGTAGTCCGCGCGGG - Exonic
1077048113 11:555121-555143 GCGGGGGCTGAGAGGCGCGCGGG + Intronic
1077213559 11:1384452-1384474 GAAGAGCCTGTGGGCCACGCGGG - Intergenic
1078102249 11:8336810-8336832 GCGGTGGCTGTGGGGCCCGCGGG + Intergenic
1078901946 11:15650294-15650316 GTGGGGCTTGGGGGCCGCCCTGG + Intergenic
1081524832 11:43920308-43920330 GCGGGGCGTGTGGGGGGCGGGGG - Intergenic
1082787839 11:57326667-57326689 GTGGGGCCTGTGGGCTGGGCAGG - Intronic
1083303762 11:61752560-61752582 GCGGGGCGCGTGGGGCGGGCAGG + Intergenic
1083741245 11:64712759-64712781 GCGGGGCGAGTGGGCGGGGCCGG - Intronic
1083741471 11:64713718-64713740 GCGGGGGCCGGGGGCCGGGCGGG - Exonic
1083780610 11:64915535-64915557 GCGGGGCCTGCAGGCTGAGCTGG + Intronic
1086590448 11:88508967-88508989 GCCGGGGCTGGGGGCCGCGGTGG + Exonic
1086719405 11:90101496-90101518 GGGGAGCCTGTGGTCCGGGCAGG - Intergenic
1088630121 11:111766394-111766416 GCGGGGCCTGGGCGCGGGGCGGG - Intronic
1089556238 11:119317206-119317228 GCGGGGGCTGGGGGCTGCGCGGG - Intronic
1089560155 11:119339779-119339801 GCAGGCCCGGTGGGCCCCGCGGG + Exonic
1091394190 12:143539-143561 CTGGGGCCTGTGGGCTGCTCTGG - Intronic
1092318061 12:7440326-7440348 GCAGGGCCGGTGGGCGGCGGCGG - Intronic
1094338990 12:29389607-29389629 GCAGCGCCTTTGGGCGGCGCCGG + Intergenic
1094536091 12:31324183-31324205 GCGCGGCCTGCGGGAGGCGCCGG - Intronic
1095584557 12:43836028-43836050 GCGGCGGGTGTGGGCCGAGCCGG + Intronic
1095752995 12:45730401-45730423 GCGGGGTCTGAGCGCCGCGGCGG + Intronic
1096099046 12:48957645-48957667 GTGGGGGCTGTGGGCGGCGGAGG + Intergenic
1096243890 12:49973864-49973886 GCGGGGCCTGTGGGTAGAGAAGG + Intronic
1096533484 12:52256485-52256507 GAGAGGCCTGTGGGCTGTGCTGG + Intronic
1097225753 12:57476037-57476059 GTGGGGCCTTGGGGACGCGCGGG + Intronic
1097262313 12:57726633-57726655 GCTGGGCGTGGTGGCCGCGCTGG + Exonic
1100362924 12:93894695-93894717 GCGGGGGCTGTGGGCCTCTGTGG - Intronic
1101144853 12:101831042-101831064 GCGGGCCCTGAGGGCTGGGCTGG + Intergenic
1104623864 12:130337696-130337718 GCAGGGCCTGTGGGGCGGGGCGG + Intergenic
1104857115 12:131907561-131907583 GCGGGCCCTGTGGGACCGGCTGG - Intronic
1104963324 12:132498310-132498332 TGGGGGCCTGTGGGTCCCGCAGG - Intronic
1106109032 13:26760796-26760818 GGGGAGCGTGTGGGCCGGGCGGG - Intergenic
1107605210 13:42049158-42049180 GCGGGGCCTGGGGCGCGGGCGGG + Intronic
1112091753 13:96090662-96090684 CCGGGGCCTGCGAGCCGGGCGGG - Intergenic
1113312053 13:109141026-109141048 GCAGGGCCTGTAGGGCGCGGGGG - Exonic
1113578508 13:111411645-111411667 GCTGTGCCTCTCGGCCGCGCGGG + Intergenic
1113926323 13:113943790-113943812 GCAGGGCCTGTGGCCAGGGCTGG + Intergenic
1119666992 14:76491784-76491806 CTGGGGCCTGTGGGCAGGGCTGG + Intronic
1121453938 14:94026760-94026782 GCGGGGGCTCGGGGCCGAGCTGG - Intronic
1122113192 14:99515568-99515590 GTGGGGCCTGTGGACCCCACTGG - Intronic
1122220767 14:100238357-100238379 GGGCGGCCCGGGGGCCGCGCGGG - Intronic
1122538713 14:102484485-102484507 ATGGAGCCTGTGGGCCCCGCGGG + Intronic
1123038044 14:105479234-105479256 ACGGGGCTTGGGGGCCGGGCAGG + Intronic
1124743136 15:32315379-32315401 GGGCGGCCTCGGGGCCGCGCCGG - Intergenic
1125536147 15:40441852-40441874 GCAGGGGATGAGGGCCGCGCCGG + Intronic
1126746409 15:51830021-51830043 GCGGGGGACGTGGGGCGCGCTGG + Intronic
1131144310 15:90001623-90001645 GCTGGGGCGGGGGGCCGCGCGGG - Intronic
1131257310 15:90871346-90871368 GCGGGGCCTGAGGGACGCGCCGG + Intronic
1132365141 15:101251610-101251632 GCGGGGCCTGCGGGCGGCTCGGG - Exonic
1132568390 16:633513-633535 GCCGGGGCTGGGAGCCGCGCTGG + Exonic
1132575577 16:662272-662294 GCTGCGCCTGTGGGCCGTGGGGG + Exonic
1132598014 16:762014-762036 GTGGGGCCTGTGGGCCACTGTGG - Intronic
1132598983 16:765566-765588 GCGGGGCCTGCTGCCCGTGCTGG + Exonic
1132720691 16:1314194-1314216 GCTGGGCCGGTGGGACTCGCAGG + Intronic
1132891493 16:2207019-2207041 CCGGGACCTGCGGGCCGGGCCGG - Exonic
1132987806 16:2777168-2777190 GGGGGGCGGCTGGGCCGCGCGGG - Intronic
1133009976 16:2905441-2905463 GCGGGGCCCGTGGGCAGGGGAGG + Intergenic
1133034707 16:3028318-3028340 GCGGGGCCCGTGTGCGGGGCGGG - Intronic
1133327017 16:4947972-4947994 GGGAGGCCTGTGGGCCTCACAGG + Intronic
1134063599 16:11213130-11213152 GCGTGGCCTCTGGGCCCCGAGGG - Intergenic
1134707150 16:16310679-16310701 GCAGGGCCGCTGTGCCGCGCCGG - Intergenic
1134960390 16:18401445-18401467 GCAGGGCCGCTGTGCCGCGCCGG + Intergenic
1135321807 16:21502334-21502356 GCGGGTCCTGTCGGCGGGGCGGG + Intergenic
1136025339 16:27464856-27464878 GCGGGGTCTGTGGGGAGCTCGGG + Intronic
1136187760 16:28598023-28598045 GAGGGGCCTGTGGCCCTAGCAGG - Intergenic
1136190127 16:28610481-28610503 TGGGGGCCTGTGGGCTGCACTGG - Intronic
1136333286 16:29595441-29595463 GCGGGTCCTGTCGGCGGGGCGGG + Intergenic
1136447970 16:30335472-30335494 GCGGGTCCTGTCGGCGGGGCGGG + Intergenic
1137038921 16:35591847-35591869 AAGGGGGCTGTGGGCCGAGCTGG + Intergenic
1138619090 16:58197742-58197764 GCGGGACCGGGGGGCGGCGCGGG + Exonic
1139482154 16:67236665-67236687 GCGGGGCCTGTCAGCAGGGCGGG + Exonic
1139954314 16:70685986-70686008 GCGGGGCTGGCGGGCGGCGCGGG + Exonic
1140078635 16:71723954-71723976 GCGGAGCCGGCGGGCCGCGGGGG - Intronic
1140481725 16:75265899-75265921 GCGGGGCCTCTGAGCGGCGCGGG - Exonic
1140723075 16:77788521-77788543 GCGGAGGCTGTGGACCGCGGCGG + Exonic
1141558815 16:84853525-84853547 GAGGGGCCTGTGGGCAGGGGAGG - Intronic
1141989639 16:87602662-87602684 GCGGGGCCCGCGGGCGGCGGCGG - Intronic
1142006420 16:87691484-87691506 TCAGGGCGTGTGGGCCGGGCAGG + Intronic
1142412366 16:89923219-89923241 GCGGAGCCTGCGGGCCGGGCGGG + Intronic
1142474640 17:181565-181587 GCGGGGGCTGCGGGCATCGCCGG + Exonic
1142509771 17:386098-386120 GCGGGGCCGGCGGGGCGCACAGG - Intronic
1142552976 17:752277-752299 GCGGAGGCTGTGGGCGGGGCCGG - Intronic
1142671866 17:1491324-1491346 GCGGGGCCCGAAGGGCGCGCAGG + Intronic
1144851275 17:18245306-18245328 GGTGGGCCTGTGGGCAGGGCAGG - Intronic
1144953020 17:19004200-19004222 GCGGGGAGGGCGGGCCGCGCGGG + Intronic
1145743255 17:27293970-27293992 GCGTTGCCTGGGGGCCTCGCAGG - Intergenic
1146057622 17:29589224-29589246 GCGGGGCCGGAGGGCTGGGCGGG - Intronic
1146182932 17:30709055-30709077 GCCGGGCCCGTGGGCACCGCAGG - Intergenic
1146214940 17:30971402-30971424 CCGGGGCCTCGCGGCCGCGCTGG - Exonic
1147967089 17:44199438-44199460 GAGGGGCCTGTGGGGGGCGGGGG - Intronic
1148437117 17:47693822-47693844 GCGGCGCCAGCGGCCCGCGCTGG - Intergenic
1148838434 17:50478928-50478950 GCGGCGCCTCTGGGCCGCTCTGG - Exonic
1148948456 17:51286980-51287002 CCGGGGCCTGTGGGTCGGGGGGG - Intronic
1151018427 17:70584457-70584479 GCAGGGCCTGTGGCCAGCCCAGG + Intergenic
1151401471 17:73858573-73858595 GTGGGGCGTGTGGACCGCTCAGG - Intergenic
1151779979 17:76239734-76239756 GCGGGGTCCGAGGGCCGCGAGGG - Intronic
1152093438 17:78259035-78259057 GCTGGGCCTGGGGGCCTGGCTGG + Intergenic
1152233480 17:79126388-79126410 GGGAGGGCTGTGGGCCGGGCAGG - Intronic
1152272321 17:79331901-79331923 GCTGGCCCTGTGAGCCGCACAGG - Intronic
1152396271 17:80035675-80035697 GCGGGGCGCGTGGGGCGCGTGGG - Intronic
1152465655 17:80464656-80464678 GAGGGGCCTGTGGGCAGTGGGGG + Intergenic
1152627876 17:81396552-81396574 GTGGGGCCTGCAGGCCGGGCTGG - Intronic
1152760640 17:82105524-82105546 GCGTGGCCTGTGAGCCTCCCAGG - Intronic
1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG + Intergenic
1152870556 17:82751333-82751355 GCGGGGCCCGGAGGCCGCGGTGG - Intergenic
1152917908 17:83051580-83051602 GCGGGGCCTAAGGGCTGCTCAGG + Intronic
1153226952 18:2906845-2906867 GCGGGGCCGCTGGGCCTCGGCGG - Exonic
1154060518 18:11055778-11055800 GCTGGGCCTCTGAGCCGCGCTGG + Intronic
1154503057 18:15005940-15005962 GCGGGGGCTGAGGGGCACGCAGG + Intergenic
1155910188 18:31497700-31497722 GCGGGACCTTTGGGCGGTGCTGG + Intergenic
1156099730 18:33578710-33578732 GCGGGGCCGGCGGGAGGCGCGGG - Intronic
1157610134 18:48950696-48950718 CCGGGGCCGGAGAGCCGCGCAGG - Exonic
1159102665 18:63972643-63972665 CCGGGGCCTGTGGGGTGGGCGGG - Intronic
1160373032 18:78390395-78390417 GCGGGACGTGTGGGGGGCGCAGG - Intergenic
1160374148 18:78398189-78398211 GCGGGGCCTGGGGGCCATGGTGG - Intergenic
1160453374 18:78979886-78979908 GCGGGGCCCGGGTGCGGCGCGGG - Intergenic
1160539263 18:79611532-79611554 CCTGGGCCTGTGGGCCCCTCCGG - Intergenic
1161001350 19:1912662-1912684 GCGGGGCTTGCGGGCCGTGGGGG + Exonic
1161038169 19:2096737-2096759 GCGGGGCCTGGAGGCGGAGCCGG + Intronic
1161086014 19:2335186-2335208 GCGGGGCCTGAGGGATGCGGTGG - Intronic
1161086163 19:2335712-2335734 GCGGGGCCTGAGGGATGCGGTGG - Intronic
1161250165 19:3276039-3276061 GCGGGGCCTGTGGGGAGGGTGGG + Intronic
1161314460 19:3611377-3611399 GGGTGGCCTGTGGGCAGGGCTGG + Exonic
1161314848 19:3613009-3613031 GTGGGGCCAGTGGGGCGAGCTGG - Intronic
1161428565 19:4217647-4217669 GCGGGGCCTGCGGGCCGAGCTGG + Exonic
1161443313 19:4304705-4304727 GCGGGGCCCGCGGGCCGGGCCGG + Exonic
1161746904 19:6065986-6066008 GCGGGGGCTGGGGGCGGGGCTGG + Intronic
1161779169 19:6279794-6279816 GCGGGGCCCGGGGGCGGGGCGGG - Exonic
1161959517 19:7516128-7516150 GCGGGGCCGCTGGGCCGAGGGGG + Exonic
1161973505 19:7596434-7596456 GCGGGGTCTGCGGGCCGGGTGGG + Intronic
1162445212 19:10718542-10718564 GCGGGCCCTGTGGGACGCCCTGG + Intronic
1162975878 19:14206750-14206772 GCCGGGCCCGTGGGCACCGCAGG + Intergenic
1163051734 19:14689775-14689797 GCGGGGCCTGTGCGCGGGGGCGG - Intronic
1163304901 19:16471880-16471902 GGCGGGCCTGGGGGCGGCGCCGG - Intronic
1164831809 19:31328358-31328380 GCGGGGACTGCGGGCCACGTTGG + Intronic
1165049870 19:33134592-33134614 GCGGTGCGGGAGGGCCGCGCAGG + Intronic
1165784460 19:38453037-38453059 GCGGGGCCTGTGGGCCCAGGGGG + Intronic
1166179374 19:41096001-41096023 GCGGGGCTTGTGGGAGGGGCGGG + Exonic
1166306883 19:41940336-41940358 GAGGGGCCTGTCGGCCGCGCGGG + Intergenic
1166706182 19:44909166-44909188 GCAGCGCCAGTGGGCCGGGCTGG + Exonic
1167071762 19:47226260-47226282 GCGGGGACTGAGGGCGGCGCTGG - Intronic
1167311171 19:48738866-48738888 GCGGGGCTTGTGGGACTCGCGGG - Intronic
1168351753 19:55680028-55680050 GAGTGGCCTGTGGGCAGGGCTGG + Intronic
1168536059 19:57171992-57172014 GCGGGGGCCGCGGGCCGCGAGGG + Intergenic
925191918 2:1892036-1892058 GCAGGACCTGTGCGCCACGCGGG - Exonic
925402597 2:3586298-3586320 GGGGGTCCTGTGGGCCTTGCTGG + Intergenic
925725376 2:6865977-6865999 CCGGCGCCTGGGGACCGCGCAGG - Intronic
925730591 2:6917501-6917523 GCGGGCCGTGCGGGCTGCGCGGG + Exonic
925778241 2:7355947-7355969 GTGGGGCAGGTGGGCCCCGCAGG + Intergenic
925984798 2:9206936-9206958 GCGGGGCCTGGCGGCGGAGCAGG - Exonic
927159178 2:20242156-20242178 GCGAGGCCTGGGGTCCGCGGTGG + Intergenic
927698483 2:25252614-25252636 GCGGGGCCGGGGGGCCGGGAGGG + Intronic
927714120 2:25341644-25341666 GCGGGGACGGCGGGCCGGGCTGG - Intronic
927809340 2:26173031-26173053 GCGGGGCCCGGGGGCGGGGCCGG + Intergenic
928904612 2:36356209-36356231 GCGGCGCGTGTGCCCCGCGCAGG + Exonic
929452819 2:42048151-42048173 CCGGGGCCGGGGAGCCGCGCGGG + Exonic
930651656 2:53970511-53970533 CCCGGGCCTGCGGGCCGGGCCGG - Intronic
934618525 2:95790078-95790100 GCGGGGGCTGTGGGGCGCCGAGG + Intergenic
934642368 2:96034481-96034503 GCGGGGGCTGTGGGGCGCCGAGG - Intronic
934892992 2:98087067-98087089 GCGCGGTCTGTGGGCGGGGCCGG + Intergenic
934966666 2:98730536-98730558 GCGGGGCAGGTGGGCGGGGCCGG - Intronic
935275778 2:101474315-101474337 GCGGCGGCCGTGGGCGGCGCTGG + Intronic
937047134 2:118857756-118857778 GCGGGAGCTGTGGGCTGAGCCGG + Intergenic
938502222 2:131836110-131836132 GCGGGGGCTGAGGGGCACGCAGG + Intergenic
940316694 2:152335085-152335107 GCGGGGCGAGTGGGCGGAGCCGG + Intergenic
941095891 2:161239014-161239036 GCCGGCGCTGGGGGCCGCGCGGG - Intergenic
942292583 2:174487092-174487114 GCGGGGCCTGAAGGCGGGGCGGG - Intronic
942890477 2:180980982-180981004 GCGGGGCCGGGGGGCCGCGTGGG + Intronic
947399122 2:229714587-229714609 GCGGGGCCTGCGGGGCGGGGCGG + Intergenic
948460771 2:238128922-238128944 GCGGGACCAGTGGGCGGGGCGGG + Intronic
948477816 2:238231708-238231730 GCGTGGCCTCCGGGCCGCGGCGG + Intergenic
948824631 2:240568366-240568388 GCGGGGCCGGGGCGCCGGGCGGG - Intronic
949019752 2:241734549-241734571 GCGGGGCCCGTTAGGCGCGCGGG + Intergenic
1168965327 20:1894958-1894980 GCGGGGCAGGTGGGCAGCGGCGG + Intronic
1170885107 20:20333913-20333935 GTGGGGCCTGTGGGCTGGTCAGG + Intronic
1170998659 20:21391696-21391718 GCGGGGTCTGCGGGCTGGGCCGG - Intergenic
1170999433 20:21397421-21397443 GGGGGGCCTGGGGCGCGCGCCGG + Exonic
1172271272 20:33657034-33657056 GTGGGGCCTGTGCGCCTCCCAGG - Intergenic
1172404358 20:34676795-34676817 GCGGGGCCTGAGGGCGGGGCTGG - Intronic
1172581242 20:36050604-36050626 GCAGCGCCTTTGGGCGGCGCTGG - Intergenic
1172777658 20:37416744-37416766 GCGGGGTCTGTGGGCGGCCGAGG - Intergenic
1172781346 20:37438536-37438558 GCGGGGCCGGTGGGGCGGGAAGG + Intergenic
1173479922 20:43390438-43390460 GCGGGGGCGGTGGGGGGCGCTGG + Intergenic
1173736262 20:45363618-45363640 GCTGGGCCTGTGGCTGGCGCTGG + Exonic
1174216765 20:48921855-48921877 GCGGGGGCTGACGGCCCCGCGGG - Intergenic
1174392027 20:50223593-50223615 CGGCGGCCTGTGGGCCGGGCCGG + Intergenic
1175116879 20:56689121-56689143 GCGGGGCCTGTCTGCCACGGTGG - Intergenic
1175303405 20:57959099-57959121 GCGGGGCTGGGGTGCCGCGCTGG + Intergenic
1175756792 20:61535335-61535357 GCTGAGCCTGAGGGCCGCCCCGG - Intronic
1175891761 20:62318879-62318901 CCGGGACCTGGGGGCCCCGCAGG - Exonic
1176300317 21:5096181-5096203 GAGGGGCCTGTGGGGCGGGCGGG - Intergenic
1178351161 21:31873714-31873736 GCGGCGCCTGGGGGCGGCGGCGG + Exonic
1178916667 21:36708899-36708921 GCGGGAGCTGTGGGCCTGGCAGG + Intronic
1179438124 21:41375878-41375900 GCTGGGCCTGTGCTCCGGGCAGG - Intronic
1179461424 21:41538028-41538050 GCAGGGCGGGTGGGCTGCGCTGG - Intergenic
1179784222 21:43720366-43720388 GCGGGGCCTGCGGTGCGGGCTGG + Intronic
1179856705 21:44165730-44165752 GAGGGGCCTGTGGGGCGGGCAGG + Intergenic
1179881841 21:44296296-44296318 GCAGGGCCTAGGGGCCGCGGGGG - Intronic
1179917124 21:44484912-44484934 GCGGGGCGTGAGGGGCGTGCGGG + Intergenic
1179917135 21:44484947-44484969 GCGGGGCGTGCGGGGCGTGCGGG + Intergenic
1179917143 21:44484965-44484987 GCGGGGCGTGGGGGGCGTGCGGG + Intergenic
1179938996 21:44626357-44626379 ATGGGGCCTGTGGGCAGGGCTGG + Intronic
1180046761 21:45309950-45309972 GCAGGGCCTGTGAGCGACGCTGG + Intergenic
1180062482 21:45392789-45392811 GCTGGGCCTGTGGGCAGAGGGGG + Intergenic
1180086343 21:45509548-45509570 GGTGGGCTTGTGGGTCGCGCCGG - Exonic
1180209489 21:46286174-46286196 GAGGGGCCAGTGGGCAGCGCGGG - Exonic
1181165226 22:20979611-20979633 CCGTAGCCTGTGGGCCGGGCAGG - Exonic
1181956297 22:26589982-26590004 GCGCGGGCTGGGGGCCGTGCGGG - Intronic
1183294064 22:37019590-37019612 GCGGGGCCTCCGGGACCCGCGGG + Intronic
1183337181 22:37256495-37256517 GAGTGGCCTGTGGGGCCCGCTGG - Intergenic
1183384330 22:37506284-37506306 GCGGGGCCTGGAGGCGGAGCGGG - Exonic
1183484524 22:38082026-38082048 ACGGGGCCTGTGGGCAGGGCAGG + Exonic
1184186563 22:42868913-42868935 CCTGGGGCTGTGGGCCGAGCCGG + Intronic
1184766918 22:46577000-46577022 GCGGGGCCGGGGTGGCGCGCGGG + Intronic
1184856875 22:47151073-47151095 GAGGGGCCTGTGAGCTGCGTGGG + Intronic
1185117048 22:48943984-48944006 GCGGGGCCCGTGAGCCTCCCCGG + Intergenic
1185161624 22:49233489-49233511 GCGGGGTCTGTGTGCCTCACTGG - Intergenic
949559380 3:5187974-5187996 TCGGGGCCCGTGGGCCGGCCTGG + Exonic
950104640 3:10380326-10380348 GCGAGGCCTGTTGGCAGAGCAGG - Intronic
950509919 3:13420015-13420037 GCGGGCGCCGTGGGCCGGGCTGG - Intronic
950759227 3:15206133-15206155 GCGCGGGCTGTGGGCGGGGCCGG - Intronic
952270372 3:31825067-31825089 GCTGGGCTTGTGGGCCACCCAGG + Intronic
953638688 3:44685498-44685520 GCCGGGGCTGCGGGCTGCGCTGG - Intergenic
953963435 3:47283676-47283698 GCTGGGCCTGCTGGCCGCGTGGG + Intronic
954025775 3:47781927-47781949 GCGGGGCCGGGCGTCCGCGCCGG - Intronic
954201506 3:49025966-49025988 GCCGGGCCAGTGGGCCGGGCTGG + Intronic
954318369 3:49813562-49813584 GCAGGGCCTGGGGGCCGAGGTGG - Exonic
954622890 3:52005810-52005832 GAGGGGCCTGGGGGCTGCGGGGG + Intergenic
954750117 3:52808749-52808771 GAGGGGCCTGTGGGAGGGGCTGG + Exonic
955357894 3:58246584-58246606 GAGGGGACTGTGGGCTGGGCTGG + Intronic
956813616 3:72888330-72888352 GCGGGGCGCGCGGGCAGCGCTGG - Exonic
961463088 3:127065220-127065242 GAGTGGCCCGTGAGCCGCGCTGG - Intergenic
961658962 3:128458261-128458283 GAAGGGCCTGTGGGCCGCCTTGG + Intergenic
962134989 3:132722866-132722888 GCGGGGCATGTGGGCGGGGCAGG + Intergenic
962230537 3:133661845-133661867 GAGGGGGCTGTGCGCCGGGCTGG - Exonic
966188363 3:177248282-177248304 GGGGGGCGTGTGGGGCGGGCAGG - Intergenic
966919237 3:184601662-184601684 GCGAGGACTGTGGGCCTCTCTGG - Intronic
968353625 3:198081810-198081832 GCCAGGCCTGTGGGCCCCCCTGG + Intergenic
968458698 4:713027-713049 GTGGGGCCTGTGGGCCCTGTGGG + Intronic
968472947 4:790225-790247 GAGGGGCCAGTGGGCTGCGGAGG + Intronic
968674666 4:1871196-1871218 GCGGCGGGTGGGGGCCGCGCGGG - Intergenic
968804056 4:2761332-2761354 GCAGGGCCAGTGGACCACGCAGG - Intergenic
968809531 4:2793580-2793602 GCGGGGCCAGAGGGGCGCGAGGG - Intronic
969240387 4:5893138-5893160 GCGGGGCCTCTGGGCGGCTGCGG + Intergenic
974047281 4:56908372-56908394 GCGGGGGCTGGCGGCCGAGCAGG + Intronic
975779013 4:77819760-77819782 GCGGGGCGGGCGGGCCGGGCCGG + Intergenic
978777065 4:112515308-112515330 GCGGGGCGCGTCGGCAGCGCGGG - Exonic
978778360 4:112524104-112524126 GCGGGGCTTCGGGGCCGCGGGGG + Intergenic
984928389 4:184826108-184826130 GCGGGGCCTGCGGGCGGGGCGGG - Intronic
984973404 4:185209869-185209891 CCGGCGCCTGCGGCCCGCGCGGG - Intronic
985452790 4:190070213-190070235 GTGGGGTCTGTGAACCGCGCGGG - Intergenic
985453776 4:190073506-190073528 GTGGGGTCTGTGAACCGCGCGGG - Intergenic
985454765 4:190076799-190076821 GTGGGGTCTGTGAACCGCGCGGG - Intergenic
985936478 5:3101521-3101543 GCATGGCCTGGGGGCCGGGCTGG - Intergenic
987989344 5:25190670-25190692 GCAGCGCCTTTGGGCGGCGCCGG - Intergenic
989011324 5:36876364-36876386 GCGGCGGCTGGAGGCCGCGCTGG - Intergenic
990211132 5:53482125-53482147 GCTGCGCCTGGAGGCCGCGCGGG + Intronic
993386345 5:87267757-87267779 GCGGGGGCGGGGGGCCGGGCCGG - Intergenic
997305117 5:132830799-132830821 AAGAGGCCTGTGGCCCGCGCGGG - Exonic
998228841 5:140346527-140346549 GCGGGGTCGGGCGGCCGCGCGGG - Exonic
999696293 5:154190829-154190851 GCGGGGCCGGCGGGGCGCGGCGG + Exonic
1001345750 5:170896887-170896909 GGGGCGCTTGTGAGCCGCGCCGG - Intronic
1001617745 5:173056577-173056599 GCTGGGGCTCTGGGCCGGGCCGG + Intronic
1001906594 5:175478598-175478620 GCGGGACCTGCGAGCAGCGCGGG + Exonic
1002167547 5:177357960-177357982 ATGGGGACTGTGGGCAGCGCCGG - Exonic
1002184267 5:177446970-177446992 GCGGCGGCTGCGGGCCGGGCGGG + Intronic
1002771139 6:292000-292022 GCGGGGCCTGGCGGACGCGCAGG - Intronic
1002927097 6:1611030-1611052 GCGGGGGCTGGCGGCCGGGCGGG - Exonic
1003065806 6:2902987-2903009 GCGGTGGCTGTGGGCCGCCAAGG + Intronic
1003098002 6:3157324-3157346 GCGGGGGCTGGAGGCCGCGGCGG - Intronic
1006135427 6:31892904-31892926 CCGGGGGCTGTGGGCCGAGAGGG + Exonic
1006436437 6:34028075-34028097 GCGGGGCCTGGGGCCCGAGAGGG + Intronic
1006665176 6:35688550-35688572 GCGGGGCCGGTGCTCCCCGCGGG - Intronic
1007774981 6:44219792-44219814 GCGGGGCCGGGGGGCCTGGCGGG + Intronic
1007996682 6:46315394-46315416 GCGGGGCCTGTGGTCTGTGTAGG + Intronic
1008545258 6:52577503-52577525 CCGGGGGCTGAGGGCGGCGCGGG + Intergenic
1011607376 6:89118101-89118123 CCGCGGCCCCTGGGCCGCGCCGG - Intergenic
1013195684 6:107843605-107843627 GCAGGGCCAGTGGGCAGAGCAGG - Intergenic
1013514552 6:110874387-110874409 GCGGGGACGGTGGCCAGCGCTGG - Intronic
1017163707 6:151390019-151390041 TTGGGGCGTGAGGGCCGCGCGGG + Intronic
1018774466 6:166999773-166999795 GCGGGGCTTGGGGGCCACACGGG + Intronic
1018946223 6:168348182-168348204 GAGGGGCCTGTGAGCTGGGCGGG - Intergenic
1019308535 7:347770-347792 GCGGGGACTGTGGGGCAGGCTGG - Intergenic
1019795251 7:3043815-3043837 GAGGGGGCTGCGGGCGGCGCGGG + Exonic
1020235093 7:6348991-6349013 GCGGGGCCTGTGGGCCGCGCAGG - Intergenic
1020418267 7:7969643-7969665 GCTGGGGCCGCGGGCCGCGCCGG - Exonic
1021868259 7:24979823-24979845 GGGGGGCCTGGCGGCGGCGCGGG - Intronic
1023955708 7:44885295-44885317 GCGGCGGCGGTGGGCCGTGCGGG - Exonic
1024018256 7:45338829-45338851 CCGGGGGCTGTGGGCGGCGGGGG + Intergenic
1024301267 7:47889470-47889492 TCGGGGCCTGTGGGGCTCCCTGG + Intronic
1024453829 7:49580267-49580289 GTGGGGCCTTGGGGCCGGGCAGG - Intergenic
1024673482 7:51617521-51617543 ACAGGGCCTGTGGGCAGCCCCGG - Intergenic
1025089593 7:56051499-56051521 GCGGGGCTTGTGCTCCGCGGGGG - Exonic
1026665360 7:72336495-72336517 CCGCGGGCTGGGGGCCGCGCCGG - Intronic
1026776816 7:73235614-73235636 GCGGGGCCAGTGTGCGGGGCGGG + Intergenic
1027017665 7:74788984-74789006 GCGGGGCCAGTGTGCGGGGCGGG + Intronic
1027070357 7:75156948-75156970 GCGGGGCCAGTGTGCGGGGCGGG - Intergenic
1029374881 7:100171525-100171547 GCGGGGCCGGTGAGCCTCGGGGG - Exonic
1029438527 7:100575241-100575263 CCGGGGGCTGCGGACCGCGCTGG - Exonic
1032230609 7:130070637-130070659 GCGGGTCATGTCGGCCGCCCAGG + Exonic
1034313774 7:150111691-150111713 GCGGGGCTTGTGGGCGGAGGAGG - Intergenic
1034468855 7:151245400-151245422 GCGGGCCCTGGGGGACCCGCAGG - Intronic
1034793124 7:153989101-153989123 GCGGGGCTTGTGGGCGGAGGAGG + Intronic
1035021753 7:155804649-155804671 GCGGGGCCTGTTCGGAGCGCTGG + Intronic
1035061686 7:156074208-156074230 GTGGGGCCTGAGGGGCGCCCAGG + Intergenic
1035266087 7:157690969-157690991 GCGGGGCGCGGCGGCCGCGCTGG - Intronic
1035553078 8:544855-544877 GCGGGCCCAGTGGGCCGGGCGGG + Intronic
1035637117 8:1155670-1155692 GAGGGGCCTGGGGGCCTCGGAGG - Intergenic
1038542535 8:28401978-28402000 GCGGGGCCTGTTGCCAGGGCTGG - Intronic
1039046553 8:33455725-33455747 GCGGGACCTGAGGGCTGCACAGG - Intronic
1039885942 8:41653979-41654001 GCGGGGCCTGTGAGCGGAGAGGG - Intronic
1041271398 8:56112993-56113015 GCTCGGCCTCTGCGCCGCGCTGG + Exonic
1041752756 8:61278866-61278888 CTGGGGCCTCTGGGCCGAGCTGG + Intronic
1049146091 8:141001695-141001717 GCGGGGCCGCAGGGCCGCTCAGG - Intronic
1049270405 8:141692674-141692696 TCGGTGCCTGTGGGCCGGGCAGG + Intergenic
1049384229 8:142333068-142333090 CCGGGGCCTCTGGGCCAGGCTGG + Intronic
1049532016 8:143159655-143159677 GGTGGGCCTGGGGGCGGCGCGGG + Exonic
1049585466 8:143430699-143430721 GCGGGGCCGGCCGGCGGCGCGGG - Intergenic
1049604065 8:143521015-143521037 GAGAGCCCTGTGGGCCGGGCGGG - Intronic
1049635163 8:143684331-143684353 GCGGGGCCTGCCGGCTGCGGCGG + Intergenic
1049665392 8:143840635-143840657 GAGGGGCCTGGAGGCTGCGCGGG - Intronic
1049665511 8:143841001-143841023 GCGGGGCCCGGGGGCGGAGCCGG + Intergenic
1049665531 8:143841089-143841111 GCGGGGCCTGGGCGCGGCCCGGG - Intergenic
1049716357 8:144094973-144094995 GCGGGGCCTGTCGGGTGGGCGGG - Intergenic
1049798380 8:144506668-144506690 GCGGGGCCTGCGGGGTGGGCAGG + Intronic
1051665077 9:19461351-19461373 GCGGCTCCTGGGGGCGGCGCGGG + Intergenic
1054781932 9:69173975-69173997 GTGGGGGCTGCGGGCCGCTCGGG + Intronic
1056806217 9:89730950-89730972 GTGCGGCCTGTGGGCGGCGTGGG + Intergenic
1057152427 9:92807837-92807859 GCGGGGCGTGAGGGCGGTGCTGG + Intergenic
1057801272 9:98192681-98192703 GCGGGGCCGGAGGGCGGGGCGGG + Intergenic
1058995125 9:110292175-110292197 CCGGGGGCTGTGGGCAGGGCTGG - Intergenic
1060793892 9:126502299-126502321 GCAGGGCATGTGGGCAGAGCAGG - Intronic
1061089923 9:128420795-128420817 GCGGGGCCTGGGGCCCGGGCGGG - Exonic
1061128201 9:128689727-128689749 GCGGGGCCCGGGGCGCGCGCGGG + Intronic
1062142349 9:134966635-134966657 GATGCGCCTGTGGGCCGAGCAGG + Intergenic
1062428119 9:136515435-136515457 GGGGGGCCAGTGGGCAGGGCGGG - Intronic
1062497219 9:136837569-136837591 GCGGGGGCTGAGGGGCACGCAGG - Exonic
1062537650 9:137027946-137027968 GCGGGCGCTGGGGGCGGCGCGGG - Intronic
1062550927 9:137086254-137086276 GCGGGGACTGTGGGTCCAGCCGG + Intergenic
1062558914 9:137130355-137130377 GCGGGGACTGTGGGTCCAGCCGG - Intergenic
1062565300 9:137161592-137161614 GCGGGGCCTGAGGGCTGGGTGGG + Intronic
1062607207 9:137353647-137353669 GCGGGGGCTGAGGGTCCCGCAGG - Intronic
1187443916 X:19344141-19344163 GCGGGGCCGGAGGGCAGGGCGGG + Intronic
1189004920 X:36985569-36985591 GAGCTGTCTGTGGGCCGCGCGGG - Intergenic
1192952282 X:76029608-76029630 GCGGGGCCTGGGGGCGCGGCAGG + Intergenic
1195963183 X:110406260-110406282 CCGGGGCCTGTGGGGCGTGGGGG - Intronic
1198205329 X:134460111-134460133 GCGGGGCCTGCGGGGCGTGGCGG + Intergenic