ID: 1020235646

View in Genome Browser
Species Human (GRCh38)
Location 7:6353364-6353386
Sequence CCTAAACTTGCATTCTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020235646_1020235649 -10 Left 1020235646 7:6353364-6353386 CCTTAGAAGAATGCAAGTTTAGG No data
Right 1020235649 7:6353377-6353399 CAAGTTTAGGCCAGGCGCAGTGG 0: 3
1: 27
2: 300
3: 2310
4: 10100
1020235646_1020235653 26 Left 1020235646 7:6353364-6353386 CCTTAGAAGAATGCAAGTTTAGG No data
Right 1020235653 7:6353413-6353435 TGCGTCATTGCACTCCAGCCTGG 0: 140
1: 6578
2: 49699
3: 157690
4: 225306
1020235646_1020235651 -4 Left 1020235646 7:6353364-6353386 CCTTAGAAGAATGCAAGTTTAGG No data
Right 1020235651 7:6353383-6353405 TAGGCCAGGCGCAGTGGTGGTGG No data
1020235646_1020235654 27 Left 1020235646 7:6353364-6353386 CCTTAGAAGAATGCAAGTTTAGG No data
Right 1020235654 7:6353414-6353436 GCGTCATTGCACTCCAGCCTGGG 0: 409
1: 15692
2: 104545
3: 226381
4: 218418
1020235646_1020235650 -7 Left 1020235646 7:6353364-6353386 CCTTAGAAGAATGCAAGTTTAGG No data
Right 1020235650 7:6353380-6353402 GTTTAGGCCAGGCGCAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020235646 Original CRISPR CCTAAACTTGCATTCTTCTA AGG (reversed) Intergenic
No off target data available for this crispr