ID: 1020238469

View in Genome Browser
Species Human (GRCh38)
Location 7:6374470-6374492
Sequence GAGCGGCGGCGCCGGCGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 877
Summary {0: 1, 1: 2, 2: 17, 3: 127, 4: 730}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020238457_1020238469 -6 Left 1020238457 7:6374453-6374475 CCCCGCCCGGAACCTGGGAGCGG 0: 1
1: 0
2: 2
3: 13
4: 90
Right 1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG 0: 1
1: 2
2: 17
3: 127
4: 730
1020238459_1020238469 -7 Left 1020238459 7:6374454-6374476 CCCGCCCGGAACCTGGGAGCGGC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG 0: 1
1: 2
2: 17
3: 127
4: 730
1020238460_1020238469 -8 Left 1020238460 7:6374455-6374477 CCGCCCGGAACCTGGGAGCGGCG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG 0: 1
1: 2
2: 17
3: 127
4: 730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020238469 Original CRISPR GAGCGGCGGCGCCGGCGCGG GGG Intergenic
900162909 1:1232801-1232823 TAGAGGCGGCGGCGGCGCGCGGG - Exonic
900171994 1:1273798-1273820 AGGCGGCGGCGGCGGCGCTGCGG - Exonic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
901019790 1:6249801-6249823 GAGCGGCGGCGCGCGCGGGACGG + Exonic
901131257 1:6963343-6963365 GAGGGGCGGCGCGGGCAAGGAGG - Intronic
901443645 1:9293616-9293638 CCGCGGCGGCTCCGGGGCGGCGG - Intronic
901666683 1:10830289-10830311 AAGGGGCGGCGCCGGGGTGGGGG - Intergenic
902856527 1:19210218-19210240 GAGCGGCGGCGAAGAGGCGGCGG - Exonic
902870682 1:19312124-19312146 TAGCAGCGGCGCCTGCGCGTTGG + Exonic
903132731 1:21290232-21290254 GCGCGGCGGCGGCGGCGCCAGGG - Intronic
903476016 1:23619639-23619661 CGGTGGCGGCGTCGGCGCGGCGG + Intronic
903777125 1:25800297-25800319 GAACGGGCGCGGCGGCGCGGTGG - Exonic
903828649 1:26161963-26161985 GGGCGGCGGCGGCGGCTCGGAGG + Exonic
903846587 1:26282753-26282775 GAGCGGGGGTGCCGGCGTGTTGG + Exonic
903925230 1:26826923-26826945 GCGCGGCGGGGCGGGGGCGGCGG - Exonic
904181365 1:28668884-28668906 GGGCGGGGGGGCGGGCGCGGGGG + Intronic
904256933 1:29260086-29260108 GAGGGGCGGGGCCGGCGACGGGG + Intronic
904641952 1:31937941-31937963 GGCCCCCGGCGCCGGCGCGGGGG + Intronic
904782917 1:32964340-32964362 GGGCGGTGGCCCGGGCGCGGAGG - Exonic
905107681 1:35573991-35574013 GAGCGGGGGCGCCGGCCCGTAGG - Exonic
906488165 1:46247496-46247518 GAGGGGCGGGGCGGGGGCGGGGG - Intergenic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
906640512 1:47438225-47438247 GGGCGGCGGCAGCGGCGGGGGGG + Exonic
910200150 1:84690559-84690581 GGCCTGCGGCGCCGGCGCGCGGG - Intronic
910758984 1:90717498-90717520 GCGCGGCGGTGGCGGCGCGGAGG + Intergenic
910909553 1:92218715-92218737 GAGGGGAGGGGCAGGCGCGGGGG - Intronic
910930925 1:92441966-92441988 TGGGGGCGGCGCCTGCGCGGGGG + Intergenic
911072969 1:93846972-93846994 GCGCGGCGGCGCTCGCGCGCAGG + Intronic
911633989 1:100213393-100213415 GGGCGGCTGCGGGGGCGCGGCGG - Intronic
912337561 1:108876969-108876991 GAGCCGGGGCGCAGGCGCAGAGG + Exonic
912619519 1:111140564-111140586 GAGCGCCGGCGCGGGAGCCGGGG + Intronic
912818140 1:112846330-112846352 GAGCGCCGGGCCGGGCGCGGTGG - Intergenic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913453559 1:119008426-119008448 GAGGGGCTGGCCCGGCGCGGCGG + Intergenic
913518263 1:119623290-119623312 GCGCGGGGGCGGCGGCGCTGCGG - Exonic
913959314 1:143326997-143327019 CAGCGCTGGCGCCGGCGTGGCGG + Intergenic
914053633 1:144152377-144152399 CAGCGCTGGCGCCGGCGTGGCGG + Intergenic
914125564 1:144814164-144814186 CAGCGCTGGCGCCGGCGTGGCGG - Intergenic
914197335 1:145454426-145454448 GGGCGGCGGGGCCGGCGGGGCGG - Intergenic
914455351 1:147831652-147831674 GAGCAGCTGCCCGGGCGCGGTGG - Intergenic
915302973 1:154961992-154962014 GGGCGGTGGAGCCGCCGCGGAGG + Intronic
915326917 1:155085481-155085503 CCGGGGCGGGGCCGGCGCGGCGG + Intronic
916107305 1:161441294-161441316 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916108892 1:161448712-161448734 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916110480 1:161456093-161456115 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916112065 1:161463503-161463525 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916113652 1:161470884-161470906 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916694397 1:167221320-167221342 GGGCGGCGGGGCCGGGGCAGAGG + Intronic
916773634 1:167937011-167937033 GAGCGGGGGCCCCGGGGCGGAGG + Intronic
916890255 1:169106612-169106634 CGGCGGCGGCGGCGGGGCGGGGG - Exonic
916890258 1:169106615-169106637 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
917817503 1:178725501-178725523 GAATGGCGGCGGCGGCGCTGCGG + Intronic
918151093 1:181798739-181798761 TATCGGCGGCGGAGGCGCGGGGG + Exonic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
921023672 1:211259127-211259149 GAGCGGCGGCCACGCCTCGGTGG + Intronic
922496501 1:226062226-226062248 GCGCGCCGGGGCCCGCGCGGGGG + Intronic
922496657 1:226062735-226062757 GAGCGACGGCGGCGCGGCGGCGG - Intronic
922513140 1:226186454-226186476 GCGCGGCGGAGGAGGCGCGGCGG - Exonic
922648830 1:227318846-227318868 GAGCCGGGGCCACGGCGCGGCGG - Intergenic
922766395 1:228158681-228158703 GGGCCGCGGCGCGGGGGCGGGGG - Exonic
922766399 1:228158687-228158709 GGGCGGGGGCCGCGGCGCGGGGG - Exonic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
923008006 1:230067385-230067407 GGGCGGCGGCGCCGGCAGGAAGG + Exonic
923461768 1:234214709-234214731 GAGCGCCGCCGCCTGCGTGGGGG + Intronic
923506300 1:234609237-234609259 GAGCGGCGGCGGCTTGGCGGCGG + Exonic
923506486 1:234609849-234609871 GACGGGCCGCGCGGGCGCGGGGG + Intergenic
924706586 1:246507323-246507345 GAGGGGCGGGGCGGGCGCGGTGG + Intergenic
1062759938 10:10736-10758 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1062759945 10:10765-10787 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1063115129 10:3067490-3067512 GGGCGGGGGCGCGGGCGGGGCGG + Intronic
1063165122 10:3454647-3454669 GAGCGACCGCGCCGGCACAGTGG + Intergenic
1063418233 10:5890290-5890312 GGCCGGCGGCGCGGGCCCGGCGG + Intronic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064209034 10:13347975-13347997 AAGCGGCGGGCCCGGCGCGGGGG - Intronic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1064981954 10:21174162-21174184 GCGCGGCGGCGGCGGCGAGGCGG - Intronic
1065022240 10:21510046-21510068 GAGCGGCAGGGCCAGCGCCGCGG - Intergenic
1065100359 10:22325555-22325577 GTGCGGCGACGCCGGGGGGGCGG - Intronic
1065100373 10:22325586-22325608 CGGGGGCGGGGCCGGCGCGGGGG - Intronic
1065188870 10:23192958-23192980 GAGCGGCGGCTGCGGCGGCGCGG + Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1065712900 10:28533752-28533774 GAGCGGCCGCGCGGGCGGGCGGG + Intronic
1066080709 10:31928527-31928549 CGGCGGCGGCGGCGCCGCGGAGG - Intronic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1067110624 10:43397157-43397179 GGGCCGGGGCGCCCGCGCGGCGG + Intronic
1067478092 10:46579236-46579258 CAGCGGGGGCGGCGGGGCGGAGG - Intronic
1067616648 10:47762551-47762573 CAGCGGGGGCGGCGGGGCGGAGG + Intergenic
1069386174 10:67884927-67884949 GTGCGGCGGCGGCGGCGCTGTGG + Exonic
1069438554 10:68407344-68407366 GAGCGGCGCCCCGGGCGGGGCGG + Intergenic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070329994 10:75409700-75409722 GAGCGGGCGGGCCCGCGCGGCGG - Intergenic
1070800831 10:79243557-79243579 CGGCGGCGGCGGCGGCGCGGGGG - Intronic
1072591629 10:96832734-96832756 CGGCGGCGGCGCCGGGGCGCCGG - Intronic
1073251042 10:102120464-102120486 GGGAGCCGGCGCCGGCGCGAGGG - Intergenic
1073577994 10:104641257-104641279 GAGGTGCGGGTCCGGCGCGGGGG - Exonic
1074829912 10:117241093-117241115 GAGCGGCGGCGGCGGGGCGCTGG + Exonic
1075144572 10:119872502-119872524 GAGTGGCGGCGCCGGGGGGCGGG - Intronic
1075697479 10:124447611-124447633 CGGCGGCGGCGGCGGCTCGGGGG - Exonic
1076306136 10:129467000-129467022 GTGCGGCGGCGCCGGGCCTGAGG - Intergenic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076373910 10:129971355-129971377 GTGCGTCGGCGCGGGGGCGGGGG + Intergenic
1076722094 10:132397179-132397201 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1076722097 10:132397182-132397204 CGGCGGCGGCGGCGGGGCGGGGG + Exonic
1076864434 10:133160113-133160135 GAGGGGCGGAGCCGGCGCCCAGG - Intergenic
1077008519 11:369982-370004 GGGGGGCGGGGGCGGCGCGGGGG + Intronic
1077014958 11:395393-395415 CAGCGGAGGGGCCGGCCCGGCGG + Intronic
1077018504 11:407258-407280 GAGGGGCGGGGCCTGCGGGGTGG + Intronic
1077021868 11:420557-420579 GAGCAGCGGCGCCAGCGGGAAGG + Exonic
1077065538 11:639563-639585 GCGCGGGGGCGCCGGGGCGCGGG - Intronic
1077092829 11:787475-787497 GAGCCCCGACGCCGGCGGGGAGG - Exonic
1077253786 11:1571876-1571898 GAGCGGAGGCGCCGGCGGGGCGG - Intronic
1077386199 11:2270635-2270657 AGGCGACGGCGGCGGCGCGGAGG - Exonic
1077492759 11:2869786-2869808 CAGCGGCGGGGCCGGCTCTGCGG + Intergenic
1078066317 11:8081445-8081467 GCCCGGAGGGGCCGGCGCGGGGG - Intronic
1078210289 11:9265045-9265067 GAGTGGCGGCGGCGGCGGAGGGG - Exonic
1078210383 11:9265289-9265311 CTGCAGCGGCGGCGGCGCGGAGG - Exonic
1078594420 11:12674487-12674509 GGGCGGCGGGGCCGCGGCGGCGG - Intergenic
1079362002 11:19777280-19777302 CAGCAGCGGCCCCGGGGCGGGGG + Intronic
1079689401 11:23403531-23403553 CGGCGGCGGCGGCGGCGCGGGGG - Intergenic
1080386650 11:31814510-31814532 GAGGCGCAGCGCCGGCGCGCTGG + Intronic
1080606607 11:33869505-33869527 AAGCGGAGGCGCAGGAGCGGCGG - Exonic
1081872955 11:46391586-46391608 CCGCGGCGGCGCGGGGGCGGGGG - Intergenic
1082025111 11:47565821-47565843 GAGCGGCGGGGACGGGGCAGGGG - Intronic
1083289177 11:61680390-61680412 GGGCGCCGGCGCCGGCGCGAAGG - Intergenic
1083572585 11:63768438-63768460 GGGCGGGGGCCCCGGCGTGGGGG - Intronic
1083812269 11:65112504-65112526 GAGCCGCGGCGCCTGCGGGAAGG - Exonic
1083903017 11:65652757-65652779 GACGGGCGGCGCCGGCGAGACGG - Intergenic
1084420092 11:69056178-69056200 GAGCGGCAGGGCTGGCGCTGAGG - Intronic
1084526806 11:69703223-69703245 GGGCGGATGCGCCGGGGCGGGGG - Intronic
1085037472 11:73308841-73308863 GAGCGGGCGCGGCTGCGCGGGGG - Exonic
1085044011 11:73343102-73343124 GGGCGGGGGCGCCGGGGTGGCGG - Intronic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1087014622 11:93543236-93543258 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1087761815 11:102110665-102110687 GGGCGGAGGCGCCGGGGCGGGGG + Exonic
1088920630 11:114257848-114257870 TCGCGGCGGCGCGGGCGCTGGGG + Exonic
1089527586 11:119107437-119107459 GTCCGGCGGGGCCCGCGCGGTGG + Exonic
1089842124 11:121427390-121427412 CTGGGGAGGCGCCGGCGCGGCGG - Intergenic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090238208 11:125164816-125164838 AGGCGGCGGCGGCGGCGCGGCGG + Intronic
1090238636 11:125166566-125166588 GCGCGGCGGGGCGGGAGCGGTGG + Intronic
1090293888 11:125569551-125569573 GAGCCGCGGCGGCGGAGCTGTGG + Exonic
1090350662 11:126105816-126105838 GAGAGGTGGGGCCGGCCCGGAGG - Intergenic
1090817787 11:130314447-130314469 CGGCGGCGGCGGCGGCCCGGGGG + Exonic
1091372987 11:135076361-135076383 CTGCGCCTGCGCCGGCGCGGCGG + Intergenic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091550375 12:1531206-1531228 GGTCGGCGGCGCAGGCGGGGCGG + Intronic
1091558669 12:1594415-1594437 GCGCGGCGGCGCGGGCGGAGCGG - Intronic
1091616227 12:2053043-2053065 GCGCGGCGGGCCCGGAGCGGCGG + Intronic
1091740829 12:2959451-2959473 ACGCGGCGGCGCCGGAGCTGCGG - Exonic
1091762455 12:3096044-3096066 GGGCGGCGCTCCCGGCGCGGCGG + Intronic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1094375402 12:29783748-29783770 CAGCGGCGGCGGCGGCGCGATGG - Exonic
1094682683 12:32679683-32679705 CAGGGGCGGAGCCGGCGCGGCGG + Intronic
1095752372 12:45727543-45727565 GTGAGGCGGCGGCGGCGCGGCGG + Intergenic
1096389405 12:51217486-51217508 AAGCCGCGGGGCCGGGGCGGCGG - Intronic
1097190395 12:57216790-57216812 GAGGCGCGGAGCCGGCGCTGGGG - Exonic
1097676068 12:62603467-62603489 GAGAGGCGGCGCCGGCGCCCGGG - Exonic
1098550336 12:71755017-71755039 GGTCGGCGGGGCCGGGGCGGTGG + Exonic
1098550374 12:71755141-71755163 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1098550375 12:71755144-71755166 CGGCGGCGGCGGCGGGGCGGCGG + Exonic
1101970717 12:109310076-109310098 CAGCGGCGGCGCGGGCCGGGCGG - Intergenic
1102197157 12:111033976-111033998 CGGCGGCGGCGGCGGCGCGGCGG + Intergenic
1102278354 12:111599390-111599412 GCGCGGCGGAGCGGGCGGGGCGG - Exonic
1102457169 12:113077961-113077983 GGGAGGCGGCGCGGGCTCGGCGG - Exonic
1103407718 12:120687395-120687417 GGCCGGCGTGGCCGGCGCGGCGG + Exonic
1103424730 12:120823227-120823249 GGGCGGCGGCGGTGGCGGGGAGG + Intronic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1104001598 12:124863896-124863918 GTCCGGCGGCGCCGGCGATGGGG - Intronic
1104049652 12:125186807-125186829 GAGCGGCGGCGCCCGGCCCGGGG - Intergenic
1104376284 12:128267422-128267444 CAGCGGCGCCGCCGGCCCGGGGG - Exonic
1104857364 12:131908422-131908444 GAGTGGTGGGGCCGGCGCGCCGG + Intronic
1104961623 12:132490766-132490788 TCGCGGCGGCGGCGGCGCGGGGG - Exonic
1105413838 13:20192798-20192820 GCGCGGCGGGGCCGGGGCGGGGG + Intronic
1105678079 13:22696628-22696650 GAGCGGCGGCGGGGGCCCTGGGG + Intergenic
1105745621 13:23375126-23375148 GAGCAGCGGCTGTGGCGCGGCGG - Exonic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1106516977 13:30464819-30464841 GCGCGGCGGCGGCGGCGGGCGGG + Intronic
1106568515 13:30906697-30906719 GGGAGCCGGCGGCGGCGCGGGGG + Exonic
1107468173 13:40667266-40667288 GAGCCGCGGCGCCGGGGGTGGGG - Intergenic
1107481531 13:40789642-40789664 ACGCGGCCACGCCGGCGCGGCGG + Exonic
1107787286 13:43969476-43969498 GTGCGGGGGCGACGGCACGGTGG + Intergenic
1108227465 13:48303971-48303993 GGGCGGCGGCGGCGGTGCCGGGG - Exonic
1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG + Intronic
1108541712 13:51452373-51452395 GGGCGGCGACCCCGGCCCGGCGG - Intronic
1110318202 13:74134290-74134312 GGGCGGGGGCGGCGGCGGGGAGG + Intergenic
1110596627 13:77326952-77326974 TAGCGGCGAGGGCGGCGCGGGGG - Intronic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112734348 13:102400463-102400485 TGGCGGCGGCGCTGGCGAGGAGG - Intronic
1113480408 13:110616006-110616028 GAGCGGCGGAGCCCGCGCGGTGG + Intronic
1113542016 13:111115910-111115932 GAGGGGCGGCGCGGGCGGCGGGG + Intronic
1113724315 13:112587437-112587459 GAGCGGCTGCGCCGCGGAGGTGG - Intronic
1113820660 13:113209878-113209900 GAGCGGGGGCGCCGGGGCGCCGG + Intronic
1114668944 14:24398844-24398866 GGGCGGGGGAGCCGGCGGGGGGG - Exonic
1115028485 14:28767720-28767742 GGGCGCCGGCGCCGGGGGGGAGG + Exonic
1115235794 14:31207673-31207695 CGACGGCGGCGGCGGCGCGGCGG + Intronic
1115474569 14:33800608-33800630 GGGCGGGGGCGGCGGCGCGGGGG + Exonic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1115851785 14:37595144-37595166 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1116657971 14:47674991-47675013 CGGCGGCGGCGGCGGCGCGCTGG + Intergenic
1117315109 14:54565988-54566010 GGGCGGCGGCGACGGCACGCGGG - Intergenic
1117478254 14:56118582-56118604 TAGCGGCGGCGCGGACTCGGCGG + Exonic
1117690414 14:58299386-58299408 GAGCGGCGGAGGCGGGGCGCGGG + Intronic
1117875931 14:60249727-60249749 GCGCGGCGGCGGCGGCGGGCAGG + Intronic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1117920793 14:60723771-60723793 CGGCGGCGGCGGCGGCGTGGTGG + Exonic
1118339102 14:64879833-64879855 TGGCGGCGGCGGCGGCGCAGGGG + Exonic
1118350999 14:64972366-64972388 GGGCGGCGGCGGCGGCGCAGGGG - Intronic
1119249036 14:73136548-73136570 GAGCCGCGGCGGCAGCGGGGCGG + Exonic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119500896 14:75126786-75126808 GCGAGCCGGCGGCGGCGCGGCGG - Exonic
1119743260 14:77027565-77027587 GACGGGCGGCGGCGGCCCGGGGG + Exonic
1119759656 14:77141544-77141566 GTGCGGCGGCGGCGGCGCGGGGG - Intronic
1119821017 14:77616412-77616434 GCGCGGCGGGGCCGGGGTGGCGG - Intronic
1120993249 14:90396957-90396979 GCGAGGCGGCTCCGCCGCGGCGG + Intronic
1121101573 14:91253581-91253603 GAGCGGCCCCGCGAGCGCGGGGG - Intronic
1121339018 14:93094029-93094051 GAGCGGTGGAGCCGAGGCGGTGG - Intronic
1122081691 14:99271293-99271315 CAGCGGCGGCAGCGGCGCGGCGG - Intronic
1122131008 14:99604456-99604478 GAGGGGCGGGGCGCGCGCGGGGG + Intergenic
1122221171 14:100239802-100239824 CAGCGGCGGGGCCGGCGCGGCGG + Exonic
1122221233 14:100240054-100240076 GTGCGGCGGCGGGGGCGCGGCGG + Intronic
1122275120 14:100587200-100587222 GGGCGCGGGCGCGGGCGCGGAGG - Intronic
1122558012 14:102592010-102592032 GGGCGGGGGCCGCGGCGCGGGGG - Intergenic
1122581987 14:102777136-102777158 GCGCGGCGGCGGGGGCGCGGCGG + Intergenic
1122582080 14:102777386-102777408 GGGCGGCGGGGGCGGGGCGGCGG + Intergenic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1122630135 14:103103976-103103998 GAGCGGAGGCAGCGGCTCGGCGG - Exonic
1122959423 14:105087667-105087689 CAGCGGCGGGGCGGGCGGGGAGG + Intergenic
1122993298 14:105248980-105249002 CGGCGGCGGCGCTGGCGCGGGGG - Exonic
1123004532 14:105314900-105314922 GAGCGGCGGGGCCGGCGCCATGG + Exonic
1202899776 14_GL000194v1_random:28356-28378 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1202899789 14_GL000194v1_random:28390-28412 CAGCGCCGGCGCAGGCGCGGGGG - Intergenic
1202899805 14_GL000194v1_random:28426-28448 CAGCGCCGGCGCAGGCGCAGGGG - Intergenic
1202929127 14_KI270725v1_random:23293-23315 CAGCGCCGGTGCCGGCGCGGCGG - Intergenic
1123423184 15:20147989-20148011 CAGCGCCGGCGCGGGCGTGGCGG + Intergenic
1123532410 15:21154528-21154550 CAGCGCCGGCGCGGGCGTGGCGG + Intergenic
1124957179 15:34367176-34367198 CAGCGGCGGCGGCGGCGCTCTGG + Exonic
1125677858 15:41512073-41512095 ATGGGGCGGCGCCGGCGCCGGGG - Intronic
1125834456 15:42737161-42737183 GAGGGGCGGGGCCGGCGGCGGGG + Intergenic
1126087330 15:45022718-45022740 GCGCTGCAGGGCCGGCGCGGTGG + Intergenic
1126592556 15:50354777-50354799 CAGCGGCGGCGCGGGCGCCCAGG + Intronic
1127439029 15:58987748-58987770 CAGTGGCGGCGACGGCGAGGAGG + Intronic
1127606511 15:60592478-60592500 GGGCGGCGGCGGCGCGGCGGCGG - Intronic
1128322564 15:66703496-66703518 GCGGGGAGGCGCCGGCGCGCAGG + Exonic
1129082467 15:73052632-73052654 CAGCGGCGGCGACAGCGCCGCGG - Exonic
1129189136 15:73927407-73927429 GGGCGGCGGCGTGGGCGCGGGGG + Exonic
1129710911 15:77819859-77819881 GGGCGGCGGCGCCGCGGAGGGGG - Intronic
1129710914 15:77819862-77819884 GAAGGGCGGCGGCGCCGCGGAGG - Intronic
1129742122 15:77994367-77994389 GAGCGGCGGCGGCAGAGCTGGGG - Intronic
1129752822 15:78077691-78077713 GCGCAGCGGCCGCGGCGCGGAGG - Intronic
1129893783 15:79089485-79089507 CGGCGGCGGCGGCGGCGCAGGGG + Intronic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1130656422 15:85794706-85794728 GAGCGGGGGCGCGGGTGCTGCGG + Intronic
1132055675 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG + Exonic
1132383122 15:101380341-101380363 GAGCGGAGGCGCCGGGGCAGAGG + Intronic
1132569208 16:636858-636880 CAGCGGCGGCGCACGCCCGGAGG - Intronic
1132576840 16:668233-668255 GAGGGTAGGCGCCGGCCCGGGGG + Exonic
1132734725 16:1379703-1379725 GCGGGGCGGGGCCAGCGCGGAGG - Intronic
1132779506 16:1614792-1614814 GGCCGTCGGCGCCGGCCCGGGGG - Exonic
1132828893 16:1918132-1918154 GGGCGCGGGGGCCGGCGCGGGGG + Exonic
1132915278 16:2340574-2340596 GAGCCTGGGCGCCGGGGCGGCGG + Exonic
1132968570 16:2673492-2673514 GGGCGGCGGCGGCGGTGCGACGG - Intergenic
1133020563 16:2965036-2965058 GAGGGGCGGGGCCTGCGCTGGGG + Intronic
1133079289 16:3305691-3305713 GAGCGGCGGCGGCCGCAGGGAGG + Intronic
1133784358 16:8963370-8963392 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1134419324 16:14071340-14071362 GAGCGGCGGCGGCGGCGGCCGGG + Intronic
1134527789 16:14957760-14957782 GGGAGGCGGCGGCGGCGCAGGGG - Intergenic
1135016163 16:18926432-18926454 GTGCGACAGCGGCGGCGCGGCGG - Exonic
1135517619 16:23148953-23148975 CGGCGGCGGCGTGGGCGCGGCGG + Exonic
1135822009 16:25692804-25692826 GAGCGGCGGCGGAGGCGCCCAGG + Exonic
1136399510 16:30010069-30010091 GGGCGGCGGGGGCGGCGGGGAGG - Exonic
1136861570 16:33707311-33707333 CAGCGCCAGCGCCGGCGCGGCGG - Intergenic
1137268054 16:46884723-46884745 GGGCGGCGGCGCTGGTCCGGCGG + Exonic
1138595126 16:58025731-58025753 GCGCGGCGGCCGCGGCGCGCGGG + Exonic
1138619100 16:58197772-58197794 GGGTGGCGGCGGCGGCGCGGCGG + Exonic
1139364829 16:66427042-66427064 GAGCCGCGCCGCCGCCGAGGGGG + Intergenic
1139402939 16:66696649-66696671 GAGAGGCGGCGGCGGCGGGCGGG - Exonic
1139496935 16:67326768-67326790 TCGCGGCGGCGCGCGCGCGGGGG + Intergenic
1139890546 16:70251090-70251112 GGGCGGCGGCGCCCCTGCGGCGG + Exonic
1140393381 16:74607190-74607212 GCGGGTCGGCGCCGGCGGGGCGG - Intergenic
1140504810 16:75464564-75464586 GAGCGGCGGCAGCGGCGGGTCGG - Exonic
1141665309 16:85462721-85462743 GGGAGGCGGCGCCGGCCGGGCGG + Intergenic
1141831313 16:86511244-86511266 GGGCGGCTGCGGCGGCGCGGCGG + Exonic
1142121356 16:88388104-88388126 GAGCGGCCGAGCAGGCGCGAGGG + Intergenic
1142132356 16:88436877-88436899 GGGCGGCGGCGCGGGCGTGTGGG - Exonic
1142376748 16:89710651-89710673 GAGCGGCAGGGCCGGGGCCGTGG - Exonic
1142379022 16:89721429-89721451 GAGCGGGGGCGCTGGCACCGCGG + Intronic
1142395347 16:89828565-89828587 CAGCTGCGGCGGCGCCGCGGCGG + Exonic
1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG + Intergenic
1203123065 16_KI270728v1_random:1555496-1555518 CAGCGCCAGCGCCGGCGCGGCGG - Intergenic
1142764777 17:2058893-2058915 GAGCGGCGGGGGCGGCGCGCAGG + Exonic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143527257 17:7479684-7479706 CGGCGGCGGCGGCGGCGCTGGGG - Intronic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144339746 17:14301685-14301707 GAGCAGCAGCCCCGGCGCGGCGG - Exonic
1146053305 17:29568653-29568675 GGGCGGCGCGGGCGGCGCGGGGG + Exonic
1146058705 17:29593557-29593579 GAGGGACGGCGCCGGAGCCGGGG - Exonic
1146132635 17:30291964-30291986 CGGCGGCGGCGGCGGCGGGGAGG + Exonic
1146371112 17:32266054-32266076 GGGCTGCGGAGCGGGCGCGGAGG + Intergenic
1146716202 17:35089076-35089098 AGGCGGCGGCGGCGGCGCTGGGG - Intronic
1146763486 17:35498065-35498087 GAGCGGCGGCGAGGGCGGCGGGG + Intronic
1146955858 17:36936115-36936137 GAGGCGCGGCGCCGGCGCGGGGG - Intergenic
1147132841 17:38419214-38419236 GAGGGGCGGGGCCGGCGGGGCGG + Intergenic
1147139716 17:38454145-38454167 GAGCCGCGGGGCCGGGGCCGGGG + Intronic
1147194010 17:38753115-38753137 GAGCGGAGGGGTCAGCGCGGGGG - Intronic
1147971142 17:44219578-44219600 AGGCGGCGGCGCTGGGGCGGCGG + Intronic
1148048721 17:44759093-44759115 CAGCTGCGGAGCCGGGGCGGGGG - Exonic
1148323786 17:46771927-46771949 GAGGCGCGGCGGCGGCGCGGCGG - Intronic
1148556597 17:48582230-48582252 CACCGGCGGCGGCGGCGCGGAGG + Intronic
1148698695 17:49575886-49575908 GAGCGGCGCCGCTGGAGCCGAGG + Exonic
1148755768 17:49972245-49972267 GCGCTGCGGTGCCGCCGCGGGGG - Intronic
1149512734 17:57256574-57256596 GAGCGGCGGAGCCGGGGCAGCGG - Exonic
1150002865 17:61452318-61452340 CAGCGGCGACGTCAGCGCGGAGG + Intergenic
1150060583 17:62065369-62065391 CGGCGGCGGCGGCGGCGGGGGGG - Intergenic
1150217120 17:63476997-63477019 GCGCGGCGGGGCGGGGGCGGGGG + Intergenic
1150373663 17:64662370-64662392 GGGAGGCGGGGCCGGCGGGGCGG + Intergenic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150488917 17:65561353-65561375 GAGCCGCGGCGTGGGCGCGGGGG - Intronic
1151478543 17:74356878-74356900 CAGCAGCGGCGGCGACGCGGCGG - Exonic
1151559173 17:74861557-74861579 GCGCGGCGGGGCGGGGGCGGGGG + Intergenic
1151696676 17:75721523-75721545 TAGCGGCAGCCCAGGCGCGGAGG + Exonic
1151812552 17:76453028-76453050 GGGCGCCGGCGCCGGGACGGGGG + Exonic
1151876428 17:76870027-76870049 GAGTGACCGCCCCGGCGCGGGGG + Intronic
1152125548 17:78444572-78444594 GGGCGGGGCCCCCGGCGCGGCGG + Intronic
1152628651 17:81399802-81399824 GCGCGGCGGCAGCGGCGCTGCGG - Exonic
1152711226 17:81871259-81871281 GGGCGGAGGCGGCGGGGCGGAGG - Intronic
1152721886 17:81927479-81927501 GGGCGGTGGGGGCGGCGCGGCGG - Intronic
1152923988 17:83079423-83079445 GGGCGCGGGCGCCGGGGCGGGGG - Intergenic
1152952809 18:10932-10954 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1152952816 18:10961-10983 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1152952823 18:10990-11012 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1152952830 18:11019-11041 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1152952837 18:11048-11070 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1153052190 18:909449-909471 GAGCCTCGGCGGCGGCGCGGGGG + Exonic
1153285152 18:3449993-3450015 GGGCGGCGGTGCGGACGCGGGGG - Intronic
1153935104 18:9914219-9914241 GAGCGGGGGCGCGCCCGCGGCGG - Exonic
1154092448 18:11378316-11378338 GAGCGGCTCCGCCGGCCCAGGGG + Intergenic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1154202333 18:12308179-12308201 GAGCGGCGGGGCGGGGGCGGGGG + Exonic
1154202335 18:12308187-12308209 GGGCGGGGGCGGGGGCGCGGAGG + Exonic
1154501015 18:14998106-14998128 GTGTGGCGGCACCAGCGCGGGGG + Intergenic
1155152796 18:23135884-23135906 CGGCGGCTGGGCCGGCGCGGCGG - Exonic
1156495853 18:37524805-37524827 GAGCCGCGGCCGGGGCGCGGAGG - Intronic
1157384231 18:47248082-47248104 GGGCGTGGGCGCGGGCGCGGGGG - Intronic
1158259107 18:55588152-55588174 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1159040577 18:63320040-63320062 CGGCGGCGGCGGCAGCGCGGCGG + Exonic
1160204518 18:76822323-76822345 GGGCGCGGGCGCGGGCGCGGTGG - Intergenic
1160204665 18:76822755-76822777 GAGCGGCGGGGCGGGGGCGGGGG + Intronic
1160256201 18:77250505-77250527 GAGCGGCGGGGCGCGCGGGGAGG - Intergenic
1160453340 18:78979743-78979765 GCCCGGCGGCGGCGGCGGGGGGG + Intergenic
1160453416 18:78980008-78980030 TAGCGGCCGCGCCGACGAGGAGG - Intergenic
1160499757 18:79395856-79395878 GAGCCGCCGGGCCGGCGGGGAGG + Intronic
1160706308 19:531787-531809 GGGCGGCGGCGGCGGCGCAGAGG + Exonic
1160718731 19:588547-588569 GGCCGGCGGGGCCGGCGTGGGGG + Intergenic
1160719161 19:589995-590017 CGGCGGCGGCCCCGGCGCGGGGG - Exonic
1160853510 19:1205940-1205962 GCGCGGCGGCCGCGGCGAGGGGG + Intronic
1160859005 19:1229827-1229849 GGGCCGCGGCGCGGGCGGGGAGG + Exonic
1160896940 19:1407554-1407576 GCGCAGGGGCGGCGGCGCGGCGG + Intronic
1160930585 19:1567992-1568014 CGGCGGCGGCGGCGGCGTGGGGG - Exonic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1161265239 19:3360598-3360620 AAGCGGCGGAGCCGACGCGCCGG - Intronic
1161333752 19:3700213-3700235 GGGCTGCGGGGCCGGGGCGGGGG - Intronic
1161380283 19:3961202-3961224 GAGAGGCGGCGCGGCCGTGGTGG - Intronic
1161412517 19:4124210-4124232 GTGCTGCTGCGCAGGCGCGGCGG - Intergenic
1161450707 19:4343862-4343884 CGGCGGCGGGGCCGGGGCGGGGG + Exonic
1161461544 19:4400501-4400523 GAGCGGCTGAGGCGGCGCCGGGG - Exonic
1161571926 19:5035530-5035552 AAGCGGAGGTGCCAGCGCGGGGG - Intronic
1162021362 19:7869926-7869948 GGGCGGCGGCGGCGGGCCGGGGG + Exonic
1162128237 19:8510867-8510889 GCGCGGCGGCCCGGCCGCGGGGG + Exonic
1162128250 19:8510890-8510912 CCGCGGGGGCGCCGGGGCGGTGG + Exonic
1162145509 19:8610661-8610683 CAGCGGCGGCGACGGCGCGGAGG - Intronic
1162374461 19:10296502-10296524 GGGCGGCGGCGCTGGCGGGGCGG + Exonic
1162470876 19:10871496-10871518 TGGCGGCGGCGGCGGCGAGGCGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1162535867 19:11262518-11262540 GCGGGGCGGGGCCGGCGCGGGGG + Intergenic
1162929879 19:13952554-13952576 GAGCGGCGGCGGCGGCCCCGGGG + Exonic
1162954499 19:14090776-14090798 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1162959684 19:14118293-14118315 GAGGGGCGCGGCCGGCGCGCGGG + Intergenic
1163154497 19:15432543-15432565 GGGCGGCGGCGGCGGCGCGGGGG + Intronic
1163282233 19:16325003-16325025 GGGCGGCGGGGACGGCGGGGCGG + Intronic
1163282312 19:16325322-16325344 GGGCGGCGGCGGCGGCTCCGGGG - Exonic
1163398090 19:17075766-17075788 GAGCGGCGGGCGCGGCGGGGCGG + Exonic
1163606933 19:18280860-18280882 GGGCGGCGCCGGGGGCGCGGGGG - Exonic
1163663951 19:18594496-18594518 GAGGGGAGACCCCGGCGCGGCGG + Intronic
1164189526 19:22901662-22901684 GGGTGGCGGCGCGGGCCCGGGGG + Intergenic
1165349932 19:35269765-35269787 GAGCGGCGAGGCCGGCGCTGGGG - Intronic
1165351689 19:35279266-35279288 GGGCGGCGGCGGCTGCGTGGTGG - Exonic
1165448490 19:35869394-35869416 GAGCGGCTGCGCTGGGGTGGGGG + Intronic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1166007143 19:39915628-39915650 CAGCGGCGGCGCCTGCGTGCCGG - Exonic
1166042847 19:40213780-40213802 GAGCAGCGGCGCTGGCTCGACGG + Exonic
1166100858 19:40570632-40570654 GGGCGGTGGCGGAGGCGCGGGGG - Exonic
1166106739 19:40601348-40601370 GGGCTGGGGCGGCGGCGCGGCGG + Intronic
1166304101 19:41928011-41928033 GAGCGCCGCGGCCGGCGCAGGGG - Intronic
1166304253 19:41928592-41928614 AGGCGGCGGCGGCGGCGCGGGGG + Intronic
1166762642 19:45234569-45234591 GTGCGCCGGGGCTGGCGCGGTGG - Intronic
1166807674 19:45496905-45496927 CAGCGGCGTCGTGGGCGCGGCGG - Exonic
1167080856 19:47275247-47275269 TAGCGGCGGCGGCGGCTCAGCGG - Exonic
1167129110 19:47572915-47572937 GAGGGGCGCAGCAGGCGCGGCGG - Intergenic
1167134433 19:47608681-47608703 CGGGGGCGGCGCCGGCGCGGAGG + Intronic
1167258124 19:48443087-48443109 GCCCGCCGGCGCCCGCGCGGTGG + Exonic
1167286911 19:48603552-48603574 GAGCGGCTGGGCCGGGCCGGGGG + Exonic
1167466268 19:49652374-49652396 GGGCGGCGGGGCGGGCGCCGGGG - Exonic
1167495713 19:49817634-49817656 GGGCAGCGGGCCCGGCGCGGTGG + Intergenic
1167797546 19:51719647-51719669 GGGTGGCGGCGGCGGCGCGGGGG - Exonic
1168073097 19:53963442-53963464 GAGCGGCGGGGGCTGCGGGGAGG - Intronic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168718995 19:58544689-58544711 GCGCGTCTGCGCCTGCGCGGCGG + Exonic
1202693030 1_KI270712v1_random:104800-104822 CAGCGCTGGCGCCGGCGTGGCGG + Intergenic
1202693092 1_KI270712v1_random:105042-105064 GAGAGGCGGCGGCGGCGGAGAGG + Intergenic
925169688 2:1743513-1743535 GAGCGGGGGCGCCGCGGCTGCGG + Intronic
925894001 2:8457347-8457369 GAGCGCAGAAGCCGGCGCGGCGG - Intergenic
925927205 2:8678994-8679016 TGGCGGCGGCGGCGGCGCGCGGG - Exonic
926077315 2:9951711-9951733 GAGCGGCGGCCCCGACGGGTTGG - Exonic
926089877 2:10043198-10043220 GGGCGGCGGGGGCGGCGGGGCGG - Intronic
926089995 2:10043523-10043545 GAGGGGCGGGGCGGCCGCGGAGG - Intronic
926250972 2:11155337-11155359 GAGGGGCGGGGCGGGCCCGGGGG + Intronic
926251094 2:11155789-11155811 CAGCTGCGACGCCGGCGCGCGGG - Intronic
927472215 2:23385242-23385264 GGACGGCGGCGGCGGCGCGGGGG - Exonic
927606563 2:24491495-24491517 GAGCCGCGGCGCCGGGCCCGAGG + Intergenic
927920772 2:26970702-26970724 GGCCGGCGGCTCCGGGGCGGAGG - Exonic
927938035 2:27086331-27086353 GGTGGGCGGCGCCCGCGCGGGGG - Exonic
928518280 2:32063935-32063957 GGGCGGAGGGGCCGGCCCGGCGG - Exonic
929133500 2:38602158-38602180 GCGCGGCGGCGGCGGCGGGGAGG - Intronic
929537505 2:42792747-42792769 GCGCGGCGGCGGCAGCGCTGGGG + Intergenic
929604177 2:43224534-43224556 GTGCGGCGGCCCCGGCGGGGAGG + Exonic
929778829 2:44944497-44944519 GAGCGGCGGCGCGGGGGAGCCGG + Intronic
930358216 2:50346865-50346887 CGGCGGCGGCGGCGGCGCAGGGG - Intronic
931487324 2:62706078-62706100 GAGCGGCGGGGCCGGGGCTCGGG + Intronic
931602595 2:64019220-64019242 CAGCGGCGGAGGCGGCGCTGCGG - Intergenic
931763601 2:65436193-65436215 GAGCGGGGGCGCCGCGGCAGCGG - Intergenic
932414650 2:71566216-71566238 GAGTGGCGGGGGCGGGGCGGGGG + Intronic
932621910 2:73269660-73269682 GACCGGCGGGGCGGCCGCGGTGG - Exonic
932773992 2:74516213-74516235 GAGCGCCGGGCCCGGAGCGGTGG + Exonic
932820707 2:74897501-74897523 GGGCGGCGGCGGCGGGGAGGGGG - Intergenic
933666855 2:84971274-84971296 CGGCGGCGGCGGCGGCGGGGAGG - Exonic
933953367 2:87349162-87349184 CAGCGCTGGCGCCGGCGTGGCGG - Intergenic
934237576 2:90245411-90245433 CAGCGCTGGCGCCGGCGTGGCGG - Intergenic
934275627 2:91571319-91571341 CAGCGCTGGCGCCGGCGAGGCGG + Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
934567039 2:95346829-95346851 GGGCGGCGGCGGCGGCGAGCGGG - Intronic
935237562 2:101151330-101151352 GAGAGGCGACGGCGGCGCGCGGG + Intronic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936126706 2:109794593-109794615 CGGCGGCGGCGGCGGCGGGGGGG + Intronic
936412844 2:112275739-112275761 GAGCGGCAGCGCCGGCAGCGCGG + Exonic
938406242 2:131034870-131034892 GGGCGGCGGCGGCGGCGGGCTGG - Intronic
938500186 2:131828295-131828317 GCGTGGCGGCACCAGCGCGGGGG + Intergenic
940639637 2:156333025-156333047 GAGCCGCTGCGCGGGCGCAGGGG - Intronic
941580698 2:167293124-167293146 GACCGGCAGCGCCGGCGGCGCGG - Intergenic
942314195 2:174682931-174682953 GGGCGGCGGCGCCGGAGGGGAGG - Intergenic
942319035 2:174719808-174719830 GAGCGACGGCGGCGCGGCGGCGG - Intergenic
942450903 2:176107589-176107611 CGGCGGCGGCGGCAGCGCGGGGG + Exonic
942450925 2:176107637-176107659 CGGGGGCGGCGGCGGCGCGGGGG + Exonic
944221762 2:197310550-197310572 GGGCGGCGGCGCCGGCGGGCGGG - Intronic
945189028 2:207166928-207166950 CGGCGGCGGCGCCCGCGGGGCGG - Intronic
945245233 2:207711658-207711680 GGGAGGCGGCGGCAGCGCGGCGG + Intronic
946185537 2:217978676-217978698 GAGCGGGGGCGCCGGCGGGGCGG - Intronic
946327670 2:218993144-218993166 GGGCGCCGGGCCCGGCGCGGGGG + Exonic
946362838 2:219229412-219229434 AAGGGGCGCCGCCGGCGGGGCGG - Intronic
946921448 2:224585228-224585250 GGGGGGCTGCGCTGGCGCGGCGG + Exonic
947741728 2:232487836-232487858 GCGCGGCGGGCTCGGCGCGGCGG - Intergenic
948046854 2:234951937-234951959 GGGCGGGGGCGGGGGCGCGGGGG - Intergenic
948115883 2:235494167-235494189 GCGCGGGGGCCCCGGCGCGCCGG + Exonic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
949048979 2:241887065-241887087 GAGCGGTGGTGCAGGTGCGGGGG - Intergenic
1168804453 20:664221-664243 TCGCGGCGGCGGCGGGGCGGGGG - Exonic
1168855063 20:1002347-1002369 GCGGGGAGGAGCCGGCGCGGCGG + Intergenic
1168965226 20:1894685-1894707 GGGCCCGGGCGCCGGCGCGGGGG + Intronic
1169278453 20:4248786-4248808 GGGCGGCGGCGGCGGCGTGGTGG - Exonic
1170163952 20:13343569-13343591 GGGCGGGGGCGGCGGGGCGGGGG - Intergenic
1171217387 20:23362216-23362238 CAGCGGGGGCGCCGGCTGGGAGG + Exonic
1171876843 20:30585437-30585459 CAGCGCCGGCGCAGGCGCAGGGG + Intergenic
1172037332 20:32019218-32019240 GAGCGGCGGCACGGAGGCGGCGG + Exonic
1172083217 20:32358678-32358700 GGGCGGCGGCGGCGGTGGGGGGG - Exonic
1172274977 20:33674435-33674457 GCGCGTCGGCGCCGGCGCCAAGG - Intronic
1172359609 20:34303003-34303025 GCGCGGCGGCCCCGGCGTCGCGG + Intronic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172618721 20:36306448-36306470 GAGAGGCGGCGGCGGCGCAGCGG + Exonic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1172698078 20:36835851-36835873 GAGCAGCGGCGGCGGCGGCGGGG - Intronic
1172848419 20:37944171-37944193 GGGCGGCGGGGCGGGCGCGGCGG - Exonic
1173454105 20:43189807-43189829 CAGCGGCCGCGCCGGCGATGCGG - Exonic
1173672918 20:44810426-44810448 GCGCGGCGGGGCCGGCGGGCGGG + Intergenic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1174357826 20:50010107-50010129 CGGCGGCGGCGGCGGCGAGGGGG + Intergenic
1174386697 20:50191612-50191634 GGGCGGCGGCGCAGGCATGGCGG + Exonic
1174736714 20:52972201-52972223 GGGCGGGGGCCCCGGCGCGCCGG - Intergenic
1175057163 20:56208895-56208917 GAGTGGCGGTGGCGGGGCGGGGG - Intergenic
1175057176 20:56208950-56208972 GAGTGGCGGTGGCGGGGCGGGGG - Intergenic
1175429579 20:58891881-58891903 GGGCGCCGGCCCCGGCCCGGGGG + Intronic
1175517242 20:59577453-59577475 GCGGGGAGGCGCCGGCGGGGCGG - Intergenic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1175847476 20:62066124-62066146 GGGCGCGGGCGCCGGGGCGGTGG + Intergenic
1176029798 20:63006476-63006498 GAGCAGCGGCGGCGGCGGCGCGG - Exonic
1176194525 20:63831137-63831159 GATCACCGGCGCCGGCCCGGCGG - Intronic
1176207135 20:63895278-63895300 GAGCCGCGGAGCCGGCGGGAGGG + Exonic
1176213706 20:63938637-63938659 GGGGGGCGGGGCCAGCGCGGGGG + Intergenic
1176221078 20:63969672-63969694 GCGCGGGGGCTCGGGCGCGGCGG + Intronic
1176234828 20:64049361-64049383 GGGCGGCGAGGCGGGCGCGGCGG + Exonic
1176234839 20:64049393-64049415 GGGCGGCGGGGCCGGCGGCGAGG + Exonic
1176278214 20:64286480-64286502 GCGCGCCTGCGCCGGCGCGGTGG + Intronic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176591151 21:8651891-8651913 CAGCGCCGGTGCCGGCGTGGCGG - Intergenic
1176619151 21:9043130-9043152 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1176619164 21:9043164-9043186 CAGCGCCGGCGCAGTCGCGGGGG - Intergenic
1176619179 21:9043200-9043222 CAGCGCCGGCGCAGGCGCAGGGG - Intergenic
1178351164 21:31873722-31873744 TGGGGGCGGCGGCGGCGCGGAGG + Exonic
1178513833 21:33229902-33229924 CCGCGCCGCCGCCGGCGCGGGGG - Intronic
1178707647 21:34888848-34888870 GCGCGGCGGCGGGGGCGCGCGGG - Intronic
1178707802 21:34889395-34889417 GAGCCGCGGCCCGGGCGCAGCGG - Intronic
1178948491 21:36966895-36966917 GAGGGGCAGCGCTGGGGCGGGGG + Intronic
1179775525 21:43659536-43659558 AGGCGGCGGCGGCGGCGCGCGGG - Exonic
1180095858 21:45555154-45555176 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180095873 21:45555187-45555209 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180235829 21:46458921-46458943 GCGGGGCAGCGGCGGCGCGGCGG + Intronic
1180273997 22:10629002-10629024 CAGCGCCGGTGCCGGCGTGGCGG - Intergenic
1180559059 22:16601410-16601432 GAGTGGCAGCGGCGGCGCGCGGG + Intergenic
1180782802 22:18530104-18530126 GGCCGGCGCCGCGGGCGCGGAGG + Intronic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180949415 22:19714472-19714494 CGGCGGCGGCGGCGGCGCGGAGG + Exonic
1180960629 22:19760819-19760841 GGGCGGCGGCGGCGGCCCGCGGG + Intronic
1180961933 22:19766177-19766199 GGGCGGCGGCGGCGGCGGGCGGG - Intronic
1181126364 22:20704136-20704158 GGCCGGCGCCGCGGGCGCGGAGG + Intergenic
1181239692 22:21469442-21469464 GGCCGGCGCCGCGGGCGCGGAGG + Intergenic
1181478026 22:23180576-23180598 CGGCGGCGGCGGCGGCACGGCGG + Exonic
1181902677 22:26169317-26169339 GAGGGGCCGCGGCGGCGCCGGGG - Intergenic
1182586325 22:31346100-31346122 GGGCGGGGGCGCCGGAGCGGAGG + Exonic
1183444428 22:37843886-37843908 GAGCGGCGCGAGCGGCGCGGGGG - Intronic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1183893772 22:40951349-40951371 GCGCTGCTGCGCAGGCGCGGTGG + Exonic
1184153051 22:42649428-42649450 GCGGGGCGGGGCGGGCGCGGGGG + Intronic
1184153155 22:42649826-42649848 GAGCGGAGGCGCCGCCGGCGAGG - Intergenic
1184347748 22:43923890-43923912 TGGCGGCGGCGGCGGGGCGGGGG - Exonic
1184759601 22:46537150-46537172 GGGCGGCGGCGGCGGCGCCATGG + Exonic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185037962 22:48489568-48489590 AAGCCGCGGCGCCCGCGCGGGGG - Exonic
1185055270 22:48575877-48575899 CGGTGGCGGCGGCGGCGCGGCGG + Intronic
1185420264 22:50731023-50731045 GGGCAGCGGCGACGGCGAGGGGG - Intergenic
950024264 3:9809938-9809960 GAGAGGAGGCGGCGACGCGGAGG + Intronic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950316347 3:12004745-12004767 GGGCTGCGGCGCGGGCGCCGAGG - Exonic
951717471 3:25664562-25664584 GACCGGCGGCGGCCGAGCGGCGG + Intronic
951780194 3:26354464-26354486 GGGCGGCGGAGCGGGGGCGGGGG - Intergenic
953748702 3:45594054-45594076 GAGGGGCGGGGACGGCGCGCGGG - Intronic
954004236 3:47578922-47578944 GTGCGGCGGGGCCGGCGCGGCGG - Exonic
954215223 3:49120852-49120874 TGGCGGCGGCGCCGGGACGGGGG - Intronic
954223082 3:49166295-49166317 GAGCAGCGGAGGCGGCGCAGAGG - Exonic
954256579 3:49411724-49411746 GCGCGGCCGCGGCGGTGCGGCGG + Intronic
954409678 3:50364999-50365021 GGACGGCGGCGGCGGCACGGAGG + Intronic
954540633 3:51391266-51391288 GCGCGGCGGTGGCGGCGGGGCGG - Exonic
954615556 3:51967347-51967369 CGGCGGCGGCGGCGGCACGGCGG + Exonic
954778891 3:53045392-53045414 GCGCGGCGGGCCCGGCGCGCCGG + Intronic
954778965 3:53045629-53045651 GGGCGGCGGCGGCGGCACGTTGG - Intronic
954778995 3:53045741-53045763 CGGCGGCGGCGCCGGGGCGGGGG - Intronic
954778998 3:53045744-53045766 GGGCGGCGGCGGCGCCGGGGCGG - Intronic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
955291120 3:57693079-57693101 CAGCGTCTGCGCCTGCGCGGAGG - Exonic
955769232 3:62372517-62372539 TGGCGGCGGCGGCGGCGGGGGGG - Exonic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
956675018 3:71725272-71725294 GAGCGGCGGCTCGGGGGCGGCGG + Exonic
956677936 3:71753428-71753450 CGGCGGCGGCGCCCGCGCTGGGG - Intronic
956979060 3:74614889-74614911 GGGCGGCGGCGCGGGCTGGGCGG + Intergenic
957939793 3:86990764-86990786 GAGCGGCGGCGGCAGCTCGGGGG - Exonic
958026891 3:88059269-88059291 CGGCGGCGGCGGCGGCGCAGGGG + Exonic
960101312 3:113746148-113746170 AAGCGGCGGCACAAGCGCGGCGG - Exonic
961012910 3:123448125-123448147 GGGCGGCGGCGGCGGCTCGGCGG - Exonic
961408926 3:126704402-126704424 GAGCGGCGCCGCCTGGGCCGGGG + Intronic
961828711 3:129612270-129612292 GAGGGGCAGGGCCGCCGCGGGGG + Intergenic
962277951 3:134030031-134030053 CGGCGGCGGCGGCGGGGCGGGGG - Exonic
962277954 3:134030034-134030056 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
962575511 3:136752124-136752146 ATGCGGCGGCAGCGGCGCGGGGG - Intronic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
962588075 3:136862206-136862228 GAGAGGCGGGGCACGCGCGGTGG - Exonic
963228750 3:142888962-142888984 GAGCGGCGGTGTGAGCGCGGTGG - Exonic
964201223 3:154121388-154121410 GCGGGCCGGCGCCGGCGCCGCGG + Intronic
964482779 3:157159572-157159594 CAGCGGCGGCGGCGGCGGGAGGG - Intronic
966182246 3:177197690-177197712 GGGAGGCGGCGGCGGCGCGGCGG + Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966911277 3:184561760-184561782 GAGCGGCCGCGCCAGCGCTGGGG + Intronic
967024740 3:185554878-185554900 AAGCGGCGGGCCGGGCGCGGTGG - Intergenic
968010408 3:195270767-195270789 GGGCGGCGGTGCCGGGCCGGTGG - Exonic
968133866 3:196208181-196208203 GAGCCACCGCGCCGGCCCGGGGG + Intronic
968186962 3:196639637-196639659 GAAGCGCGGCGCGGGCGCGGGGG - Intergenic
968620909 4:1603092-1603114 GTGCGGCGGCTCCTGCTCGGTGG + Intergenic
968659644 4:1793714-1793736 GGGCGGCGGCGGCGGCGGGCGGG + Intronic
968660034 4:1795052-1795074 GCGCGGGGGCGCGGGCGGGGCGG - Intronic
968660141 4:1795431-1795453 GGGCGGGGGCGCCGCCCCGGGGG - Intronic
968904894 4:3446583-3446605 GAGGGGCGGGGCCTGCGGGGAGG - Intronic
968965281 4:3766339-3766361 GAGCGGCGACGCGGCTGCGGGGG - Intronic
969344693 4:6563509-6563531 GCGAGGCGGCTCCGGAGCGGCGG + Intronic
969715854 4:8867795-8867817 TGGGGGCGGCGCGGGCGCGGCGG + Exonic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971372282 4:26028814-26028836 GAGGGGCAGCGTCGGGGCGGCGG + Intergenic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
972437249 4:39045338-39045360 GAGCGCCGGAGCCGGCGCCCGGG + Intronic
972817179 4:42657141-42657163 GAGCTCGGGCGCCGGCGCCGGGG + Intergenic
972960545 4:44447917-44447939 TGGCGGCGGCGGCGGCGCGCAGG - Exonic
973867195 4:55125645-55125667 GCGGGGCGGGGCCGGAGCGGAGG + Intergenic
974047314 4:56908488-56908510 GAGCGTCCGGGCCAGCGCGGAGG - Intronic
977257652 4:94758275-94758297 GGGCGGTGGCGGCGGCGGGGAGG + Intronic
978072585 4:104491454-104491476 GGGCGGGGGCGGCGGCGGGGGGG - Exonic
978340772 4:107719845-107719867 GAGCGGAGGCGCTGGGGAGGGGG + Intronic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
979785680 4:124712795-124712817 GAGCGGCGGGGCGGGGGCGGGGG - Intergenic
980075152 4:128287237-128287259 GTGCGGCGGCCGAGGCGCGGGGG + Intronic
980827379 4:138089048-138089070 GAGCGGCGGCAACGGCGCGGCGG - Intergenic
981615459 4:146639374-146639396 CAGCGGCGGCGGGGGCTCGGAGG + Exonic
982288738 4:153759768-153759790 GCGCGGGGGCGCGGGCGTGGGGG - Intronic
982288805 4:153759973-153759995 CTGCGGCGGCGGCGGAGCGGCGG + Exonic
982712244 4:158769105-158769127 GGGCGGCCGCGCCGCCGCGATGG + Intergenic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
983537964 4:168878139-168878161 GGGCGGGGGCGACGGCGAGGAGG - Intronic
984167524 4:176320285-176320307 GCACGGCAGCCCCGGCGCGGCGG - Intronic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
984707444 4:182857943-182857965 GAGTGCCGGCCCGGGCGCGGTGG + Intergenic
985129101 4:186723887-186723909 GAGCGCCGGCGCCGGCGGGCGGG - Intronic
985630088 5:1009509-1009531 GAGCGGCCGCAAAGGCGCGGAGG + Exonic
985896724 5:2753188-2753210 GTGCGGCTGCAGCGGCGCGGAGG + Intronic
986330694 5:6714189-6714211 GGGCGGCGGGGGCGACGCGGCGG - Intergenic
986858934 5:11904185-11904207 GAGCGGAGCTGCGGGCGCGGCGG - Intergenic
988823931 5:34915691-34915713 GAGCGGCAGCGCCGGAAAGGAGG + Exonic
989812588 5:45695940-45695962 GGGCGGCGGGGCCGGCGCGAAGG - Exonic
990041567 5:51383455-51383477 GAGCGGAGGCGCTGCGGCGGCGG - Exonic
990287080 5:54310756-54310778 GAGCGGAGGAGCCGGGGTGGGGG + Intergenic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992312074 5:75511359-75511381 CAGGCGCGGCGGCGGCGCGGCGG - Exonic
992473112 5:77077231-77077253 GAGCGGCGGCGGCGCAGCGGGGG + Exonic
992939510 5:81750028-81750050 GAGGGGCGGGCCCGGCGGGGCGG - Intronic
993168263 5:84384179-84384201 GAGCGCCGCTGGCGGCGCGGAGG - Intronic
993654354 5:90559001-90559023 GGGCGGCGAGGGCGGCGCGGAGG + Intronic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
993726944 5:91380209-91380231 CGGCGGCGGCGGCGGCGCGCGGG - Intronic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
996948196 5:129094805-129094827 CAGCGGCGCCGGGGGCGCGGGGG + Exonic
997582966 5:135028714-135028736 GGGCGCGGGCGCGGGCGCGGAGG - Exonic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
998374568 5:141682232-141682254 GGGAGGCGGGGCCGGCGCGGCGG - Intergenic
998583507 5:143403838-143403860 GGGTGGCGGGGCCCGCGCGGAGG - Intronic
999268822 5:150284553-150284575 GGGCGGCTGCGCGGGGGCGGAGG + Intronic
1000220447 5:159209257-159209279 GAGCGGCGCTGCCGGCGGGCGGG + Intronic
1001035090 5:168291778-168291800 CAGCGGCAGCGGCGGCGTGGAGG + Intronic
1001342792 5:170862463-170862485 GAGCCGCGCCGGCGACGCGGCGG - Intronic
1002093549 5:176818054-176818076 GGGCGGAGGCGGCCGCGCGGCGG - Intronic
1002184223 5:177446854-177446876 GGGAGGCGGCGGCGGCCCGGGGG - Exonic
1002487734 5:179550928-179550950 GGCCGCCGGCGCGGGCGCGGTGG + Intronic
1002591067 5:180291966-180291988 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
1002621974 5:180494464-180494486 CGGCGGCGACGGCGGCGCGGAGG + Exonic
1002771275 6:292445-292467 GAGCGGCGGGGCGGGCGGGGAGG - Exonic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002927247 6:1611570-1611592 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1003942603 6:11044121-11044143 GGGCGCCGGCGCGGGCGCTGCGG - Intronic
1004272927 6:14211271-14211293 CATCGGCGGCAGCGGCGCGGCGG - Intergenic
1004504727 6:16238651-16238673 CGGCGGCGGCGACGGCGGGGCGG - Exonic
1004615044 6:17281433-17281455 GGGCGAGGGCGGCGGCGCGGCGG - Exonic
1004627912 6:17393900-17393922 TAAAGGCGGCGCGGGCGCGGGGG + Intronic
1005348324 6:24911095-24911117 GAGCGGCGGAGCGGGCGGAGGGG + Intronic
1006304120 6:33208647-33208669 GAGGGGCAGTGCCGGCGCGGGGG + Intronic
1007600140 6:43076280-43076302 CGGCGGCGGCGGCGGCGCGCGGG + Intronic
1007665327 6:43510038-43510060 GTGGGGCGGCGCTGGGGCGGGGG + Exonic
1010141923 6:72622254-72622276 CAGCGGCGGCGGCGGCGGGCGGG + Exonic
1010414874 6:75601813-75601835 GGGCGGCGGCGTCGGGGCGGGGG + Intronic
1010428164 6:75749145-75749167 GGGCGGGGGCGCCGGGGCCGCGG - Intergenic
1012400008 6:98835089-98835111 GGGCGGTGGCGGCGGCGGGGGGG + Exonic
1012410218 6:98947966-98947988 GAGCGGCGGGCCCGGGGAGGCGG + Intronic
1012530440 6:100229174-100229196 GAGCGGCGGCGAGGCCGAGGCGG - Intergenic
1013117768 6:107115417-107115439 GACCGGCGGCGGCGGCGCTCGGG + Intergenic
1013472411 6:110476829-110476851 GAGCGGCGGCGCTGGGGGCGAGG - Intergenic
1013792718 6:113855234-113855256 AAGAGGCGGAGCCGGCGCTGGGG - Intergenic
1014947564 6:127515978-127516000 GAGGGGCGGCAGCGGCGGGGAGG - Exonic
1015149273 6:130020000-130020022 CGGCGGCCGCGCCGGGGCGGCGG + Intronic
1015149344 6:130020221-130020243 GCGCCGCGGCGGCGGGGCGGGGG + Intronic
1015366356 6:132401491-132401513 GAGCGGCAGCGGCGGCGAGCGGG + Exonic
1015773540 6:136792282-136792304 GAGAGGAGGCGGCGGCGCGGCGG - Exonic
1016378718 6:143450808-143450830 GAGCGGCGGCGGCTGCGCGGCGG + Intronic
1017164139 6:151391487-151391509 CAGAGGCGGCGGCGGCGGGGAGG - Exonic
1017672399 6:156779257-156779279 CGGCGGCGGCGGCGGCGCGCTGG - Exonic
1017877643 6:158537215-158537237 GGGCGGCGAGGCGGGCGCGGGGG - Intronic
1018330922 6:162727295-162727317 GAGGGGCGGCGGCGGGGCGAAGG + Intronic
1018669615 6:166167885-166167907 GAGCCGCGGCGGCAGCGCTGGGG + Intronic
1019186371 6:170222999-170223021 GAGGGGAGGTGCGGGCGCGGAGG - Intergenic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020395808 7:7716656-7716678 GGCCGGCGCGGCCGGCGCGGTGG + Intronic
1020445430 7:8262326-8262348 CAGCGGCGGCGCCCAGGCGGCGG - Intronic
1020552285 7:9621702-9621724 GGCCGGCGGGGCCGGCGGGGCGG + Intergenic
1021451050 7:20784418-20784440 CGGCGGCGGCGGCGGCTCGGCGG - Exonic
1021827987 7:24573550-24573572 GAGCGGCGGCAGCGGCGGCGCGG + Exonic
1021827988 7:24573553-24573575 CGGCGGCAGCGGCGGCGCGGAGG + Exonic
1021828053 7:24573757-24573779 AGGCGGCGGCGGCGGCGCCGCGG + Intronic
1021958801 7:25852587-25852609 GAGCCGGGGCGGGGGCGCGGAGG - Intergenic
1022018575 7:26376696-26376718 GGGCGGCCGCGCCGGGGCCGGGG + Intergenic
1023637590 7:42228073-42228095 AGGCCGCGGCGGCGGCGCGGTGG + Intronic
1023703055 7:42911767-42911789 GAGCCGCGGCGCTGGCGGTGGGG - Intronic
1023810264 7:43906364-43906386 GACCGGCCGCGCGGGCGTGGGGG - Intronic
1023918282 7:44606861-44606883 GAGCCGCGGGGCCTGCCCGGCGG + Intronic
1023937272 7:44748886-44748908 TGGCGGCGGCCCCGGGGCGGCGG + Intronic
1023955728 7:44885378-44885400 GGGCGGGGGCGCGAGCGCGGCGG - Intergenic
1025078707 7:55964567-55964589 CAGCGGCGGCGCCCGGGCGGTGG + Exonic
1026471129 7:70694665-70694687 GCGGGGCCGCGCTGGCGCGGCGG - Intronic
1026765164 7:73155455-73155477 AAGCGGCGGCGGGGGCGGGGCGG - Intergenic
1026817190 7:73522077-73522099 GCGCGGCCGCGCCGGCGGTGAGG - Exonic
1026840433 7:73667776-73667798 GAGCCGCGGCGCCGGGGCTGGGG - Intergenic
1026994482 7:74606607-74606629 GAGCGGTGGAGCGGGGGCGGCGG - Intergenic
1027041637 7:74965210-74965232 AAGCGGCGGCGGGGGCGGGGCGG - Intronic
1027082005 7:75237159-75237181 AAGCGGCGGCGGGGGCGGGGCGG + Intergenic
1027390276 7:77696898-77696920 CAGCGGCGGCGGCGGCGGGCAGG - Exonic
1028585554 7:92447849-92447871 CAGCGGGGGCGCAGGCTCGGGGG + Exonic
1028762280 7:94509750-94509772 TAGCGGCTGCGCCTGCGAGGGGG - Intronic
1028762314 7:94509848-94509870 GAGCAGCGGCGGCGGGGCTGGGG + Exonic
1028899139 7:96076200-96076222 GAGCGGCGGCTCAGGCGCCCGGG + Intronic
1029123114 7:98281508-98281530 CAGAGGCGCCGCCGGCGGGGCGG + Intronic
1029123245 7:98281896-98281918 GGGCGGCGGCGGGGGCGCGGCGG - Exonic
1029372418 7:100158199-100158221 GGGCGGCGGCGCCGGCGACCAGG - Exonic
1029390588 7:100271704-100271726 AAGCGGCGGCGGGGGCGGGGCGG + Intronic
1029734710 7:102459230-102459252 GAGCGGCGGGCCCGGGGAGGGGG + Intronic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1030739040 7:113086477-113086499 GCTCGGCGGCGCCTGCGCGCTGG + Intronic
1030820727 7:114087628-114087650 CGGCGGCGGCGCCGGCGGCGCGG + Intronic
1031043550 7:116862919-116862941 GGGCGGGGGCGCGGGCGCGGGGG + Intronic
1031361826 7:120857365-120857387 GGGCGGCGGGGCGGGGGCGGGGG + Intronic
1031899446 7:127392871-127392893 GACCGGGGCCGCCGGCGCGAGGG + Intronic
1032021663 7:128409989-128410011 GAGGGGCGGGGCCGCCGGGGCGG + Exonic
1032195175 7:129784584-129784606 GAGCGGAGGCACTGGGGCGGCGG + Intergenic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033390643 7:140924601-140924623 CGGCGCCGGCGCCGGCGCCGCGG - Exonic
1033683604 7:143620262-143620284 GAGCGACGGAGGCGACGCGGCGG + Intergenic
1033701008 7:143837376-143837398 GAGCGACGGAGGCGACGCGGCGG - Intergenic
1034147253 7:148884206-148884228 CGGCGGCGGCGGCGGCGCGCGGG - Exonic
1034182124 7:149147338-149147360 GAGGGGCGGAGGCGACGCGGGGG + Intronic
1034441061 7:151086358-151086380 GAGGGGCGGGGGCGGCGGGGAGG + Intronic
1034447938 7:151122952-151122974 GAGCGCCGGAGCCCGCGCTGGGG + Intronic
1034483534 7:151341716-151341738 CGGCGGCGGCGGCGGCGCGAAGG + Exonic
1034578930 7:152025936-152025958 CTGCGGCGGCGGCGGCGCGCGGG + Intronic
1034618259 7:152436597-152436619 GAGTGGCAGCGGCGGCGCGCGGG - Intergenic
1034640881 7:152601495-152601517 GACAGGCGGCCCCGGCGTGGGGG - Intergenic
1036432324 8:8702370-8702392 CAGGGGCGCCGTCGGCGCGGCGG + Exonic
1037336840 8:17800890-17800912 GGGCGGCAGCGCCGGCGGAGCGG - Intronic
1037769203 8:21789118-21789140 TGGCGGCGGCGGCGGCGCCGGGG + Intronic
1038883593 8:31640035-31640057 GGGCGGCGGAGCCGGGGCGCTGG - Intronic
1040038840 8:42896762-42896784 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1040471255 8:47737626-47737648 GCGCGGCGGCTCCGGCGACGTGG + Exonic
1040981539 8:53250902-53250924 CAACGGCAGCGCCGGCTCGGAGG - Exonic
1041689928 8:60678796-60678818 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1041839166 8:62248948-62248970 GAGCGGCGGCCGCGGGGCCGAGG + Exonic
1042040128 8:64581063-64581085 CGGCGGCGGCGGCGGCGGGGTGG + Exonic
1043563477 8:81522256-81522278 CAGCGGCGGCGCTGGAGCGGCGG + Intergenic
1044306354 8:90645605-90645627 GAGTGGCGGCGGCGGCGTGGTGG - Exonic
1045305414 8:100952691-100952713 GGGCGGGGGCCCCGGGGCGGGGG + Intronic
1045583223 8:103500814-103500836 CAGCGGCGGCACCGGCGCGGCGG - Intronic
1046103922 8:109644786-109644808 CAGTGGCGGCGGCGGCGCGTTGG - Intronic
1047202986 8:122781973-122781995 GGCCGGCGGCGCCGGCTGGGGGG - Intronic
1048214123 8:132480457-132480479 GGGCGGCGGAGGCGGCGGGGCGG - Exonic
1048554002 8:135457700-135457722 AGGCGGCGGCGGCGGCACGGGGG - Exonic
1048981176 8:139703928-139703950 GCGCGGCGGCGGCGGCGGGAGGG + Intergenic
1049406254 8:142452965-142452987 GAGCCGCGGGCCAGGCGCGGAGG - Intronic
1049532240 8:143160340-143160362 GCGGGGCGGAGCCGGGGCGGGGG + Intronic
1049585299 8:143430160-143430182 CGGCGGCGGCGGCGGCGCGGGGG - Exonic
1049620940 8:143598013-143598035 GGGCCGCGGCCCGGGCGCGGGGG - Exonic
1049689785 8:143953444-143953466 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1049746782 8:144266384-144266406 GAGGGGCGGGGCGTGCGCGGGGG + Intronic
1050090751 9:2015451-2015473 GAGCGGCGGCTGCAGCGGGGCGG - Intronic
1050874042 9:10613177-10613199 CGGCGGCGGCGGCGGCGCTGCGG + Intergenic
1051544099 9:18254648-18254670 GGGCGGGGGGGCAGGCGCGGTGG - Intergenic
1051665066 9:19461323-19461345 CGGCGGCGGCGACGGCGCGAGGG + Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1053034108 9:34810010-34810032 GGGCGGCGGCGGCGGCGCGTGGG - Intergenic
1053240025 9:36487690-36487712 AAGCGGCGGCGGCGGCGGAGGGG + Intergenic
1053690454 9:40584295-40584317 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690474 9:40584357-40584379 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690482 9:40584383-40584405 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690490 9:40584409-40584431 GGGCGGCGGCGGCGGCGCGGCGG - Intergenic
1053690499 9:40584438-40584460 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690507 9:40584464-40584486 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690527 9:40584534-40584556 CAGCGCCGGTGCCGGCGTGGCGG - Intergenic
1053752911 9:41274036-41274058 GAGCCCCGGCGCAGGCGCGGAGG - Intergenic
1054274288 9:63052959-63052981 CAGCGCCGGTGCCGGCGTGGCGG + Intergenic
1054274323 9:63053084-63053106 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054274344 9:63053154-63053176 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054301716 9:63385282-63385304 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301724 9:63385308-63385330 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301732 9:63385334-63385356 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301740 9:63385360-63385382 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301748 9:63385386-63385408 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301756 9:63385412-63385434 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301783 9:63385508-63385530 CAGCGCCGGTGCCGGCGTGGCGG - Intergenic
1054333334 9:63781656-63781678 GAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1054400479 9:64711774-64711796 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400499 9:64711836-64711858 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400507 9:64711862-64711884 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400552 9:64712010-64712032 CAGCGCCGGTGCCGGCGTGGCGG - Intergenic
1054434065 9:65196018-65196040 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434071 9:65196036-65196058 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434077 9:65196054-65196076 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434097 9:65196116-65196138 GGGCGGCGGCGGCGCGGCGGAGG - Intergenic
1054434098 9:65196119-65196141 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434106 9:65196145-65196167 GGGCGGCGGCGGCGCGGCGGAGG - Intergenic
1054434107 9:65196148-65196170 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434158 9:65196325-65196347 CAGCGCCGGTGCCGGCGTGGCGG - Intergenic
1054440856 9:65258893-65258915 AAGCCGCGGCGGCGGCGGGGGGG + Intergenic
1054489421 9:65762594-65762616 AAGCCGCGGCGGCGGCGGGGGGG - Intergenic
1054496231 9:65825355-65825377 CAGCGCCGGTGCCGGCGTGGCGG + Intergenic
1054496293 9:65825566-65825588 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054496294 9:65825569-65825591 GGGCGGCGGCGGCGCGGCGGAGG + Intergenic
1054798632 9:69325401-69325423 CAGCGGCGGCTCCTGAGCGGCGG - Intronic
1054798671 9:69325534-69325556 CAGCGGCGGCGACTGCCCGGCGG - Intronic
1055611776 9:78031582-78031604 CGGCGGCGGCGGCGGCTCGGGGG - Intergenic
1056386282 9:86099588-86099610 GAGCAGCGCCGGCGGCGCGAAGG + Intronic
1056746764 9:89310443-89310465 GAGGCCCGGAGCCGGCGCGGTGG - Intergenic
1057054390 9:91949761-91949783 GAGCATGGGCGCCGGCGCAGCGG + Intronic
1057146937 9:92764847-92764869 GTGCGGCGGCGCGGGCGGGCGGG - Intergenic
1057432227 9:95004935-95004957 GGGCGGCGGCGCGGGCGGGCGGG - Intronic
1057488651 9:95506156-95506178 GAGCGGCGGGGGCGGGACGGGGG - Intronic
1057547258 9:96027601-96027623 CGGCGGCGGCGCCGGCCTGGAGG - Intergenic
1057600046 9:96450119-96450141 GGACGGCGGCGGCGCCGCGGGGG + Intergenic
1059021307 9:110579557-110579579 GAGCGGCTGCCCCGGAGCGCAGG + Exonic
1059375133 9:113875894-113875916 GAGCCGGGGAGCGGGCGCGGGGG + Intergenic
1059414801 9:114155988-114156010 CGGCGGCGGCGGCGGCGCGCGGG + Exonic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060283475 9:122228846-122228868 GGGCGGCGGGGCCGGCGCCTCGG - Intronic
1060979859 9:127785823-127785845 GAGCCGGGGCGCCGGAGCTGGGG - Intronic
1061028954 9:128068264-128068286 GAGCGGGGGCGGCGGGCCGGCGG - Exonic
1061038668 9:128127517-128127539 GAGCTGCGGCGCTGGCCCTGGGG - Exonic
1061208312 9:129176910-129176932 GAGCGGCGGCGGCTGCTCCGAGG + Exonic
1061262629 9:129488535-129488557 GAGAGGCGGCCGCGGGGCGGGGG - Intergenic
1061321825 9:129835638-129835660 GAGGGGCGGCGGCGGCCGGGGGG - Intronic
1061453547 9:130681755-130681777 CCGCGGCGGCGCCGGGCCGGGGG - Exonic
1061898087 9:133658838-133658860 GAGCAGCGGGGCGGGGGCGGGGG - Exonic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062084519 9:134641872-134641894 GCGGGGCGGCGGCGGCGAGGAGG + Exonic
1062162472 9:135087834-135087856 GGGCGGCGGCGGCGGCGGGCGGG + Exonic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062499522 9:136846282-136846304 GCGTGGCGGCGCCAGCGCGGGGG - Exonic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062659094 9:137619068-137619090 GGGGGGCGGCGCGGGGGCGGCGG + Intronic
1062659103 9:137619092-137619114 CAGCGGCGGAGGCGGCGCGGGGG + Intronic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1062696347 9:137877999-137878021 GGGCGGCGGGGCCGGCGGGGCGG + Exonic
1062718694 9:138023655-138023677 GCGGGGAGGAGCCGGCGCGGCGG + Exonic
1202800338 9_KI270719v1_random:169980-170002 GACCGCCGGCGCAGGCGCGGAGG + Intergenic
1203621177 Un_KI270749v1:130656-130678 CAGCGCCGGTGCCGGCGTGGCGG - Intergenic
1185894322 X:3844067-3844089 GAGGGGCGCCTCGGGCGCGGAGG - Intergenic
1185899441 X:3882491-3882513 GAGGGGCGCCTCGGGCGCGGAGG - Intergenic
1185904558 X:3920920-3920942 GAGGGGCGCCTCGGGCGCGGAGG - Intergenic
1186426088 X:9465199-9465221 CTGCGGCGGCGGCGGGGCGGGGG - Exonic
1186426091 X:9465202-9465224 GCGCTGCGGCGGCGGCGGGGCGG - Exonic
1186660558 X:11664666-11664688 GAGCGACGAGGCGGGCGCGGAGG - Exonic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1187507284 X:19887784-19887806 GAGGGGCGGGGCCGGGGCCGGGG + Intergenic
1188003527 X:25002648-25002670 CGGCGGCGGCGGCGGCGTGGCGG + Intergenic
1189324596 X:40105103-40105125 CAGCGGCGGCGGCGGCGAGGAGG + Intronic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1189534519 X:41923183-41923205 GGGCGGCGGGGCCGGGGCGCGGG + Intronic
1190062260 X:47219058-47219080 GAGCCGCGGGGCCGGCGCGGCGG - Intronic
1192034376 X:67546550-67546572 CGGCGGCGGCGGCGGCGAGGCGG + Exonic
1192705550 X:73526116-73526138 GAGCGGCGGCTGCGGCTCCGGGG - Intergenic
1194977573 X:100409636-100409658 GAGAGGCGGGGCCGCCGCCGTGG + Exonic
1195668348 X:107449912-107449934 CAGCGGCGGCGCAGCGGCGGCGG - Intergenic
1195668350 X:107449918-107449940 GCGCGGCAGCGGCGGCGCAGCGG - Intergenic
1196001982 X:110795949-110795971 GAGCCAAGGCGCGGGCGCGGCGG + Intergenic
1196791589 X:119469126-119469148 CAGCGGCCGCGGCTGCGCGGGGG - Intronic
1197202991 X:123765040-123765062 GAGCGGCGGAGGCGGCTCAGCGG + Intergenic
1197415264 X:126165966-126165988 CGGCGGCGGCGGCGGCCCGGCGG + Intergenic
1198215268 X:134549629-134549651 GAGCGGCGCAGCCGGCGGAGAGG + Intergenic
1198369181 X:135974213-135974235 GAGTGGCGGGGCCTGCGGGGAGG + Intergenic
1198767084 X:140091310-140091332 GAGCTGCGGGGCCGCAGCGGCGG + Intergenic
1199772832 X:150984709-150984731 CAGCGGCGGCCCGGGCGGGGCGG - Intronic
1201152843 Y:11103185-11103207 CAGCGCCGGCGCAGGCGCAGGGG - Intergenic