ID: 1020240395

View in Genome Browser
Species Human (GRCh38)
Location 7:6390007-6390029
Sequence GAGTAGGAGAGGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3599
Summary {0: 1, 1: 3, 2: 36, 3: 395, 4: 3164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020240395 Original CRISPR GAGTAGGAGAGGAGGGAAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr