ID: 1020241132

View in Genome Browser
Species Human (GRCh38)
Location 7:6396051-6396073
Sequence AGGAGTAACAAAGGCGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020241122_1020241132 20 Left 1020241122 7:6396008-6396030 CCCTGGCTACACTTACCACCGAG 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1020241132 7:6396051-6396073 AGGAGTAACAAAGGCGTTGAAGG No data
1020241129_1020241132 2 Left 1020241129 7:6396026-6396048 CCGAGGAGGGAGTGGTGTGTGAT 0: 1
1: 0
2: 0
3: 31
4: 450
Right 1020241132 7:6396051-6396073 AGGAGTAACAAAGGCGTTGAAGG No data
1020241123_1020241132 19 Left 1020241123 7:6396009-6396031 CCTGGCTACACTTACCACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1020241132 7:6396051-6396073 AGGAGTAACAAAGGCGTTGAAGG No data
1020241128_1020241132 5 Left 1020241128 7:6396023-6396045 CCACCGAGGAGGGAGTGGTGTGT 0: 1
1: 0
2: 1
3: 10
4: 139
Right 1020241132 7:6396051-6396073 AGGAGTAACAAAGGCGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020241132 Original CRISPR AGGAGTAACAAAGGCGTTGA AGG Intronic
No off target data available for this crispr