ID: 1020241700

View in Genome Browser
Species Human (GRCh38)
Location 7:6400175-6400197
Sequence ATGTCCGTGCAAAGGTAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020241694_1020241700 4 Left 1020241694 7:6400148-6400170 CCCTTGTGAGTCCTGCATCATTT 0: 4
1: 1
2: 1
3: 20
4: 190
Right 1020241700 7:6400175-6400197 ATGTCCGTGCAAAGGTAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1020241696_1020241700 -7 Left 1020241696 7:6400159-6400181 CCTGCATCATTTGAAAATGTCCG 0: 2
1: 2
2: 2
3: 14
4: 94
Right 1020241700 7:6400175-6400197 ATGTCCGTGCAAAGGTAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1020241695_1020241700 3 Left 1020241695 7:6400149-6400171 CCTTGTGAGTCCTGCATCATTTG 0: 3
1: 1
2: 1
3: 20
4: 133
Right 1020241700 7:6400175-6400197 ATGTCCGTGCAAAGGTAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020241700 Original CRISPR ATGTCCGTGCAAAGGTAGGT GGG Exonic
909932399 1:81512011-81512033 ATGTCTGTGCAAACTTAGGATGG + Intronic
911114585 1:94233612-94233634 ATGACATTGCACAGGTAGGTAGG - Intronic
911263466 1:95715357-95715379 CTGTCTGTCCAAAGCTAGGTGGG - Intergenic
1066080704 10:31928507-31928529 AGGTGCGCGCAAAGGGAGGTCGG - Intronic
1077062676 11:624793-624815 ATGTGCGGGCAGGGGTAGGTGGG - Intronic
1083304904 11:61757086-61757108 AGGTCCGTGAAGAGGAAGGTGGG - Intronic
1085748818 11:79140915-79140937 AGGTCCCTGCAGAGGTAGCTGGG + Intronic
1085928907 11:81056886-81056908 ATGTGCCTGCAAAGGAAGGTAGG + Intergenic
1090187420 11:124747367-124747389 AAGTCCGAGAAAAGGTAGGCAGG - Intergenic
1093110546 12:15146480-15146502 ATGTCCTTGCAAAATAAGGTCGG + Intronic
1097282196 12:57852009-57852031 CTGCCTGTGCAAAGGTAGGGAGG - Intergenic
1105931562 13:25057353-25057375 CTTTCCCTGCAAAGGGAGGTAGG + Intergenic
1109127816 13:58540284-58540306 ATGTCCATTTAAAGCTAGGTTGG - Intergenic
1111976675 13:94973491-94973513 ATTTCCTTGCAGAGGTAGGGTGG - Intergenic
1114674946 14:24433704-24433726 AGGTCTGTGCAAAGTTAGGATGG - Intronic
1118321726 14:64757398-64757420 ATGTCCCTGCCAAGGAATGTGGG - Intronic
1123073362 14:105652815-105652837 ATGGCCGTGCCAGGGTGGGTGGG + Intergenic
1131781096 15:95860204-95860226 AAGTCTGTGAGAAGGTAGGTAGG + Intergenic
1132950136 16:2557100-2557122 ATCAGCGTGCAAAGCTAGGTCGG - Intronic
1132964210 16:2643070-2643092 ATCAGCGTGCAAAGCTAGGTCGG + Intergenic
1141384565 16:83607673-83607695 ATGTTCATGCAAATTTAGGTTGG + Intronic
1142679042 17:1534854-1534876 ATTTCAGTGCAAGGGAAGGTGGG + Intronic
1144239852 17:13299798-13299820 AGGTACATGCAAAGGTAGATAGG - Intergenic
1149129172 17:53275501-53275523 ATGTAACTGGAAAGGTAGGTAGG + Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1155080628 18:22406706-22406728 ATGTCCTTGCAAAGGTTTGCTGG - Intergenic
1156918966 18:42495770-42495792 GTGTCATTGCAAAGGTATGTGGG - Intergenic
1157783161 18:50458019-50458041 ATGTCCCTGCAAGGGAAGGCTGG + Intergenic
1160443902 18:78912917-78912939 ATGTCTGTGCACACGTAGCTGGG + Intergenic
1165247951 19:34508505-34508527 ATGTCCATGCAAAGGTACATGGG - Exonic
926376037 2:12228493-12228515 ATGTAAGTGCAAAGGAAGCTGGG + Intergenic
928768707 2:34679108-34679130 ATGTCTGAGAACAGGTAGGTAGG + Intergenic
929395684 2:41519617-41519639 ATTTTGGTGCAGAGGTAGGTAGG - Intergenic
930667967 2:54118083-54118105 ATGATTGTGCAAAGGGAGGTAGG + Intronic
933174266 2:79158513-79158535 AGGGCAGGGCAAAGGTAGGTGGG + Intronic
938192931 2:129299812-129299834 AGGTCCTTGCAATGGCAGGTGGG - Intergenic
939299528 2:140317531-140317553 ATGCCCTTGCAAATGTAAGTGGG + Intronic
939640007 2:144628792-144628814 ACATCCTTGCAAAGGTAGTTTGG + Intergenic
940004910 2:149001551-149001573 AAGCCCTTCCAAAGGTAGGTTGG - Intronic
940664720 2:156594229-156594251 ATGTCCGTGTAAAGTCACGTTGG - Intronic
942490032 2:176480791-176480813 ATGGCTGTGCAGAGGAAGGTTGG + Intergenic
946660487 2:221993840-221993862 ATGTGGCTGGAAAGGTAGGTAGG + Intergenic
1170838760 20:19907096-19907118 ATGTGCATGCAAGGGTAGGAGGG + Intronic
1173585029 20:44175894-44175916 AGGCCTGTGCACAGGTAGGTGGG - Intronic
1173934325 20:46847915-46847937 ATGTCAGTGCACAGGTATCTAGG + Intergenic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1177628967 21:23701890-23701912 GTGTCTGTGCAAAGGTAGGATGG - Intergenic
1178373680 21:32049041-32049063 AGGTCCCTGCAGAGGTAGGAGGG - Intergenic
1182546652 22:31080741-31080763 ATGTCTGTTCAAAGGTGTGTGGG + Intronic
1183720245 22:39558051-39558073 ACGTCCATGCCAAGGTAGGTGGG + Intergenic
956796568 3:72723428-72723450 ATTTCAGTGCAAGGGTAGGCAGG - Intergenic
965615554 3:170588427-170588449 ATGTCAGTGGAGAGGTAGGCAGG - Intronic
966331716 3:178822101-178822123 ATGAGTTTGCAAAGGTAGGTAGG - Intronic
967460935 3:189744750-189744772 ATGGCAGTGGAAAGGTAGGTGGG - Intronic
977386862 4:96351351-96351373 ATGTGTGTGCATAGATAGGTGGG - Intergenic
981806034 4:148716176-148716198 ATGTGCATGCAAAGGTGTGTGGG - Intergenic
983957362 4:173714025-173714047 ATTTCCCTTCAAAGGTAGCTTGG + Intergenic
984950622 4:185005031-185005053 ATGTTTGTTGAAAGGTAGGTCGG - Intergenic
999317896 5:150595999-150596021 ATGACCCTGCAAGGGCAGGTGGG + Intergenic
1004894590 6:20135576-20135598 ATGTCCCAGTAAAGGTAGGATGG + Intronic
1005710537 6:28500029-28500051 ATGTCCTTGCAGTGGGAGGTGGG - Intergenic
1012101958 6:95101201-95101223 ATGTCCCTACAAAGGGAGGGGGG - Intergenic
1016446077 6:144133211-144133233 ATGTCCTTGCAAATATATGTTGG - Intergenic
1016495209 6:144653667-144653689 ATGTCCATGAAAAGGTAACTGGG - Intronic
1020241700 7:6400175-6400197 ATGTCCGTGCAAAGGTAGGTGGG + Exonic
1028479314 7:91287302-91287324 ATGGCCTTGCTAAGGAAGGTAGG - Intergenic
1030568475 7:111190767-111190789 ATGTATGTACGAAGGTAGGTTGG + Intronic
1033589158 7:142796304-142796326 CTGTCTGTGCTAAGGGAGGTGGG + Intergenic
1040913178 8:52541929-52541951 ATGTGGCTGGAAAGGTAGGTTGG - Intronic
1045914368 8:107448800-107448822 ATGTTTGTGCAAACTTAGGTAGG - Intronic
1051916607 9:22216560-22216582 GTGTCCTTGCGGAGGTAGGTTGG - Intergenic
1056487736 9:87075891-87075913 AAGTCCCTGCAAAGACAGGTAGG + Intergenic
1057367539 9:94437096-94437118 ATGTGCGTGCAAAGGCCTGTTGG + Intronic
1057655789 9:96950957-96950979 ATGTGCGTGCAAAGGCCTGTTGG - Intronic
1058429607 9:104906556-104906578 AGGTCAGTGCCAAGGTGGGTGGG - Intronic
1186558017 X:10581349-10581371 ATTTCCTTGCAAAGGCAGATCGG + Intronic
1186854220 X:13610557-13610579 AGGGCTGTGCATAGGTAGGTTGG + Intronic
1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG + Intergenic
1192531903 X:71895271-71895293 ATGTCCTTGAAAAGATAGTTTGG + Intergenic