ID: 1020241909

View in Genome Browser
Species Human (GRCh38)
Location 7:6401731-6401753
Sequence GAACCACCTGAAGCCTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020241902_1020241909 19 Left 1020241902 7:6401689-6401711 CCTGAGATGTTCCTTATGGCTCA 0: 1
1: 0
2: 0
3: 16
4: 137
Right 1020241909 7:6401731-6401753 GAACCACCTGAAGCCTCCGTGGG 0: 1
1: 0
2: 1
3: 7
4: 72
1020241904_1020241909 8 Left 1020241904 7:6401700-6401722 CCTTATGGCTCAAGGCTTGAATT 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1020241909 7:6401731-6401753 GAACCACCTGAAGCCTCCGTGGG 0: 1
1: 0
2: 1
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020241909 Original CRISPR GAACCACCTGAAGCCTCCGT GGG Intronic
915666033 1:157446233-157446255 GCTCCACCTGTAGCCCCCGTGGG - Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
922513533 1:226189054-226189076 GAACCCCTTGAAGTCTGCGTGGG + Intergenic
1064863085 10:19848547-19848569 GAACCACCTGAAGCATTGGAGGG + Intronic
1066823345 10:39526111-39526133 GGACCACCTGAAGCCTTCGTTGG + Intergenic
1071509689 10:86253712-86253734 GAGCCACCTTCAGCCTCAGTGGG + Intronic
1074106627 10:110393838-110393860 GAATCGCCTGAAGACTCCATGGG - Intergenic
1074177363 10:111022576-111022598 GAACAAGCAGAAACCTCCGTGGG + Intergenic
1074637093 10:115332037-115332059 GAACCACCTGAGGCCACCTATGG - Intronic
1076056148 10:127374825-127374847 GAGCCACCAGAAGCCTGCGGAGG + Intronic
1076275086 10:129191904-129191926 GGAGCACCTGAGGCCCCCGTTGG - Intergenic
1083302439 11:61746041-61746063 GCTCCACCTGCAGCCTCCCTGGG + Exonic
1083729483 11:64645042-64645064 GCACCACCGGAAGCCTCCTCTGG - Intronic
1086966786 11:93036097-93036119 GTATCACCTGGAGCCTCCCTGGG - Intergenic
1092506543 12:9107286-9107308 GAGCCATCTAAAGCCTCCATGGG - Intronic
1096278521 12:50231586-50231608 AAGCCACCTGCAGCCTCTGTGGG - Intronic
1097185481 12:57194261-57194283 GAAACACATGAAGGCTCCATAGG + Intronic
1105425853 13:20294548-20294570 GAACCACCTCTAGACTCAGTGGG + Intergenic
1118638009 14:67765898-67765920 GAACCACCTTTAGTCTCTGTGGG - Intronic
1125905202 15:43385241-43385263 GAACCTCCTGAAGCCACCCAAGG - Intronic
1128378509 15:67094123-67094145 GGACCACCTGAGGCCTGCGTGGG + Intronic
1136485216 16:30567357-30567379 CACCCTCCTGAAGCCTCTGTGGG - Intergenic
1137711106 16:50567483-50567505 GAAGCCCCTGAAACCTCCCTAGG - Intronic
1139671257 16:68493520-68493542 CAACTACCTGCAGCCTCCCTTGG + Intergenic
1140038923 16:71392499-71392521 CAACCATCTGAAGCCTCGGTCGG + Intergenic
1141466296 16:84207967-84207989 GGAGCACCTGGAGCCTCTGTGGG + Intergenic
1141542166 16:84733725-84733747 GATGCAACTGAAGCCTCCTTTGG + Intronic
1145740974 17:27274273-27274295 GAACCACTTGAAGTCTGCCTGGG - Intergenic
1152914137 17:83024218-83024240 GGACCACCTGAGGCCTGCGCTGG - Intronic
1153836760 18:8970520-8970542 GGACCACCTGCCTCCTCCGTCGG - Intergenic
1159914018 18:74173085-74173107 GAAACACCTGAAGCCTTCCCCGG - Intergenic
1160016294 18:75143278-75143300 GAGCTACCTGAAGCCTCCTGGGG + Intergenic
1163777512 19:19226964-19226986 GAACCAAATGGAGCCTCCGTTGG + Exonic
1168465896 19:56600957-56600979 GAACCACCTGTGGCCTCTTTGGG - Intronic
927777862 2:25915872-25915894 GCTCCACCTGCAGCCCCCGTGGG + Intergenic
931673311 2:64669046-64669068 CATCCACCTGGAGTCTCCGTTGG + Intronic
940784540 2:157967864-157967886 GCTCCACCTGCAGGCTCCGTGGG - Intronic
942944600 2:181658604-181658626 GAGCCACCTGAAGCCTGCATGGG - Intronic
1175610223 20:60345070-60345092 CACCCAGCTGAAGCCTCCCTGGG + Intergenic
1179189144 21:39108415-39108437 GAGCCCCCTGAAGCCTCAGTTGG - Intergenic
1181175275 22:21031737-21031759 GAACCGCCTGAAGCCGCTGGAGG - Exonic
1183623129 22:38986459-38986481 CATCCTCCTGAGGCCTCCGTTGG + Intronic
1184583259 22:45430941-45430963 GAGCCCCCTGAATCCTCCGCCGG - Exonic
950106469 3:10392070-10392092 GAATCACCTGAAGTCTCCTCTGG + Intronic
950436724 3:12984628-12984650 GAACCACCTGCTGCCTTCCTGGG + Intronic
956705749 3:71997581-71997603 GAACCACCTGACGAATCCCTTGG - Intergenic
963069173 3:141288416-141288438 GAACAAGCTGAAGCCTCTGGAGG + Intronic
964183355 3:153913693-153913715 GAAGCAGCTGAAGCCTCCACAGG - Intergenic
969399986 4:6948223-6948245 GAACCCCCAGAAGTCTCCTTTGG + Intronic
970429020 4:15971696-15971718 GATCCACCTGAAGTCACAGTCGG - Intronic
970541841 4:17088097-17088119 TATCCAACTGAAGCCTCCATTGG - Intergenic
977472265 4:97455807-97455829 AAAGCTCCTGAAGCCTCAGTTGG - Intronic
981415567 4:144488818-144488840 GTACCACCTGAGGCATCTGTGGG + Intergenic
988834349 5:35016598-35016620 GAACCACCTTAAGCATATGTGGG - Intronic
991870204 5:71102433-71102455 GAACCACATGAATCTTCTGTGGG - Intergenic
998102798 5:139448252-139448274 GAACCACTTGAACCCTCGGGAGG + Intergenic
999697851 5:154202285-154202307 GAGCCACCTGGAGCCTCCAAGGG - Intronic
1004685804 6:17942394-17942416 GAACAATCTGAAGCCTGCCTAGG + Intronic
1010254531 6:73742743-73742765 GAACCAGCTGCAGCCTCAGGTGG - Intronic
1018817721 6:167347578-167347600 TACCCACCTGAAGCCTTCATTGG + Intronic
1018948895 6:168365546-168365568 CAGACACCTGGAGCCTCCGTGGG + Intergenic
1020241909 7:6401731-6401753 GAACCACCTGAAGCCTCCGTGGG + Intronic
1021852301 7:24820463-24820485 AAGCCTCCAGAAGCCTCCGTGGG + Intronic
1025014976 7:55431973-55431995 AAAGCACCTGAAGCCTCTGCTGG - Exonic
1028924838 7:96346709-96346731 GACCCACGTGGAGCCTCGGTAGG - Intergenic
1029664112 7:101983394-101983416 GAACCACCTCATGCCACCGAGGG - Intronic
1031918462 7:127584687-127584709 GCACCAGCTGAAGACTCAGTTGG - Exonic
1033839836 7:145360544-145360566 GCTCCACCTGCGGCCTCCGTGGG - Intergenic
1034204624 7:149304780-149304802 GAACCAGCTGCAGCTTCCTTCGG + Intergenic
1034589777 7:152129233-152129255 GAATCACCAGAATCCTCCGTGGG + Intergenic
1035955042 8:4067987-4068009 GAATCACCTGAACCCTGAGTGGG + Intronic
1043918381 8:85951591-85951613 CAAACACATGAAGCCTCCATTGG + Intergenic
1048847411 8:138614172-138614194 GAGCCACCTGAAACCCCTGTGGG - Intronic
1052970672 9:34375517-34375539 GAGCCACCTAAAGCCTTCTTTGG - Intronic
1053286881 9:36855504-36855526 GACCCCCCTGAAGCCTCACTAGG + Intronic
1060218938 9:121754415-121754437 GAACCACTTGGGGCCTCCCTGGG + Intronic
1061472652 9:130839289-130839311 GCACCACATGAAGCATCCGCTGG - Intronic
1061925039 9:133801865-133801887 GATCCCCCTGAAGCCTCTGCAGG + Intronic
1062535903 9:137020989-137021011 GAAGCGCCTGCAGCCTCCGTGGG + Exonic
1187679228 X:21750047-21750069 GAACCACCACAGGCCTCCTTAGG - Intronic
1189769688 X:44412552-44412574 GGATCACCTGAAGCCTGGGTAGG - Intergenic