ID: 1020245170

View in Genome Browser
Species Human (GRCh38)
Location 7:6424051-6424073
Sequence AGCCCTCTTCTGCTCCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020245170_1020245174 15 Left 1020245170 7:6424051-6424073 CCAGTCAGGAGCAGAAGAGGGCT 0: 1
1: 0
2: 3
3: 13
4: 185
Right 1020245174 7:6424089-6424111 GGAGTCTCAACTCATTTTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 200
1020245170_1020245173 14 Left 1020245170 7:6424051-6424073 CCAGTCAGGAGCAGAAGAGGGCT 0: 1
1: 0
2: 3
3: 13
4: 185
Right 1020245173 7:6424088-6424110 TGGAGTCTCAACTCATTTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 154
1020245170_1020245172 -6 Left 1020245170 7:6424051-6424073 CCAGTCAGGAGCAGAAGAGGGCT 0: 1
1: 0
2: 3
3: 13
4: 185
Right 1020245172 7:6424068-6424090 AGGGCTGAGCACACAGGCTCTGG 0: 1
1: 0
2: 5
3: 83
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020245170 Original CRISPR AGCCCTCTTCTGCTCCTGAC TGG (reversed) Intronic
902629833 1:17698192-17698214 AGCTCACTTCTGCTCCAGAAGGG + Intergenic
904469087 1:30724809-30724831 AAGCCACTTCTGCTCCTAACTGG + Intergenic
904896893 1:33824348-33824370 AGCCTTCTTCTGTGCTTGACTGG - Intronic
905766716 1:40607577-40607599 AGGCCTCTTCTGCTCCTGCTAGG + Intergenic
910149487 1:84125351-84125373 GGCTCTCTTCTGCTCCTAGCTGG + Intronic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
916126450 1:161575675-161575697 AACTCTCTTCTGTCCCTGACAGG + Intergenic
916136369 1:161657515-161657537 AACTCTCTTCTGTCCCTGACAGG + Intronic
917937510 1:179882932-179882954 AGCCCTCTCCTGGTCATAACAGG - Exonic
919833040 1:201555579-201555601 AGCCCTCTTCTCCTGGTGGCCGG + Intergenic
920833377 1:209485388-209485410 AGGCCTGTTCTGCTCTTGGCTGG + Intergenic
922035749 1:221846225-221846247 AGCTCTCTTCCGCTCTTGGCAGG + Intergenic
924003646 1:239582540-239582562 ATCCCTCCTCTGCTCCATACAGG + Intronic
1062822936 10:548359-548381 TCCCGTCTTCTGCTCCTGAGTGG - Intronic
1063214720 10:3913663-3913685 AGCCACCTTCTGCCCTTGACTGG - Intergenic
1064083043 10:12323855-12323877 ACTCCACTTCTGCTTCTGACTGG + Intergenic
1064733878 10:18360803-18360825 AGTCCTGTTCTGCTCCTTGCTGG - Intronic
1066063682 10:31746332-31746354 AGCCCCTGCCTGCTCCTGACTGG - Intergenic
1067739153 10:48881673-48881695 AGCACCCTTCTGCTCTAGACTGG + Intronic
1069204862 10:65668719-65668741 AAACCTCTTCTGATCCTCACTGG + Intergenic
1070753629 10:78978080-78978102 AGCCCTCATCATCTCCTGTCTGG + Intergenic
1070817665 10:79335558-79335580 AGGCCTCTACTCCTCCTGAGAGG + Intergenic
1074705394 10:116125339-116125361 AATGCTCTTCTGCTCCTGCCGGG - Exonic
1075951667 10:126483174-126483196 AGTCCTTTTCTGTTCCTGCCTGG - Intronic
1076233261 10:128839358-128839380 AGCCCTGGCCTGCTTCTGACAGG - Intergenic
1080426074 11:32155395-32155417 AGCCCTCTCCTGCCTCTTACAGG + Intergenic
1080880516 11:36315908-36315930 AGCTGTTTTCTGCTCCTAACAGG - Intronic
1081299336 11:41431414-41431436 AGCCATATTCTGAGCCTGACTGG + Intronic
1083922739 11:65789268-65789290 GGCCCTCTCCTGCACCTGACAGG - Intronic
1084179954 11:67441230-67441252 AGCCTTCTCCCGCTCCTGTCGGG + Exonic
1089608640 11:119656929-119656951 ATCCCTCTTCCCCTTCTGACAGG + Intronic
1090637085 11:128695918-128695940 AGGCCTCTTCTGATCCAGAAGGG + Intronic
1091028600 11:132163245-132163267 AGGCCTCTTCTGCTCCAGGCTGG + Intronic
1092168318 12:6356830-6356852 AGTCCTCCTCTGCTGCTCACTGG - Intronic
1092408040 12:8234343-8234365 AGCCCGCTTGTGCTCCTGGCAGG + Intergenic
1097221882 12:57455895-57455917 CTCCCTCTGCTGCTCCTGCCAGG - Intronic
1101292265 12:103382985-103383007 TGACCTCTTCTGATCTTGACTGG - Intronic
1101559117 12:105838961-105838983 AGACCTCTCCTGCACCTGTCTGG + Intergenic
1102348743 12:112176499-112176521 AGGCCTCTGCTTTTCCTGACTGG - Intronic
1102651827 12:114447754-114447776 TGCCCTCTTCTGCTCAGAACAGG - Intergenic
1103331187 12:120155157-120155179 ACCCCGCTACTGCTCCAGACAGG - Intronic
1104642747 12:130477911-130477933 TGCCCTCTCCTCCTCCTGGCAGG - Intronic
1104789439 12:131472616-131472638 GGTCCACTTCTGCTGCTGACAGG - Intergenic
1105471912 13:20703123-20703145 AGCCCTCTCCTCCTCCTGCGTGG + Intronic
1105571141 13:21603998-21604020 AGGCCGCTCCTGCTCCTGCCAGG + Exonic
1107437036 13:40389263-40389285 AGCCATTCTCTGCTCCTCACAGG - Intergenic
1107889919 13:44905303-44905325 AGCCCTGGTCTGCTCCTCCCTGG + Intergenic
1109861036 13:68199552-68199574 ATCCCTCCTCTGCTGCTGGCTGG - Intergenic
1110405138 13:75142759-75142781 AGCTCCCTTCTGCTCCACACTGG - Intergenic
1111433906 13:88181248-88181270 AGCCCTCTTGGGCTGTTGACTGG + Intergenic
1112607207 13:100918570-100918592 AACTCACTTCTGCTGCTGACAGG + Intergenic
1119175394 14:72564705-72564727 TGCCCCCTTCTCCTTCTGACTGG + Intronic
1119380086 14:74223005-74223027 AACCCTATTCTGCCCCTGCCTGG - Intergenic
1122078236 14:99249155-99249177 AGGCCCTTTCTGCTCCTGGCTGG - Intronic
1122150675 14:99724557-99724579 ACCCCACCTCTGCTCCTGGCTGG + Intronic
1122617792 14:103032290-103032312 AGGCCTCACCAGCTCCTGACTGG + Intronic
1122959621 14:105088430-105088452 TGACCTCTTCTGCTCTTGGCCGG + Intergenic
1123477563 15:20600834-20600856 TGCTCTCTCCTGCTTCTGACAGG + Intergenic
1123640453 15:22399548-22399570 TGCTCTCTCCTGCTTCTGACAGG - Intergenic
1125213889 15:37246914-37246936 AGCCATCACCAGCTCCTGACTGG - Intergenic
1128262819 15:66244297-66244319 AGTCCTCTCCTGCTCGTTACTGG + Intronic
1129903780 15:79171953-79171975 AGCCCTCTTCTGATTCTGCAAGG - Intergenic
1130918247 15:88322947-88322969 AGCCACCTCCTGCTCCTGAGTGG + Intergenic
1131016017 15:89058424-89058446 AGCCCTCTTCTGTGCCTGCGGGG - Intergenic
1131337535 15:91563649-91563671 AGCCCTCTTATGCTACTGACTGG - Intergenic
1131698304 15:94904199-94904221 TGCCCTCTTCTGTTCCTGGATGG + Intergenic
1132142951 15:99409840-99409862 AGCCCACCTCTGTTCCTGATGGG - Intergenic
1132968004 16:2670232-2670254 AGCCCTCTTGTGGCCCTGTCCGG + Intergenic
1135053391 16:19210898-19210920 AGCCCAGCTCTCCTCCTGACAGG - Intronic
1135601688 16:23789157-23789179 AGCCATCTTGTGCCCATGACGGG + Intergenic
1137753245 16:50881997-50882019 TGACCTCTTCTGCCCCTCACTGG + Intergenic
1140263962 16:73404257-73404279 AGCCCTCTTCTGTGCCTTAAGGG - Intergenic
1142698487 17:1646085-1646107 AGCCTGCCTCTGCTCCTGGCAGG + Intergenic
1143457144 17:7075722-7075744 AGCCCTCACCTGCTCCTCCCTGG + Exonic
1145385614 17:22409693-22409715 TGCCGGGTTCTGCTCCTGACGGG - Intergenic
1145955646 17:28852688-28852710 AGCCCTCTCCTGCTCAATACTGG + Intronic
1146953370 17:36921610-36921632 AGCCCTCTTGAGCTCCTGTTTGG - Intergenic
1148547345 17:48528482-48528504 AGGCCTCTTCTACCCCTGAATGG + Intergenic
1148745210 17:49914225-49914247 AGCCCTCTGTTGCTCCAGGCGGG + Intergenic
1150219845 17:63489862-63489884 AGCCCTCTTCAGCCCCTCTCTGG + Intronic
1151101704 17:71563289-71563311 ACTCCTCTTCTGCTCCTGATGGG - Intergenic
1151181867 17:72334920-72334942 AGCTCTCTTCTGCTATTGGCTGG - Intergenic
1151357832 17:73570952-73570974 AGCCCTGGTCTGGTCCTGAGTGG + Intronic
1152663059 17:81551919-81551941 CGCCCTCACCTGCTCCTGCCCGG + Exonic
1155803112 18:30133934-30133956 AGCCCTCTTCTTCCAATGACTGG + Intergenic
1157121494 18:44915648-44915670 AGCCCTGCTCTGGTCCTGCCTGG - Intronic
1157149692 18:45204237-45204259 TGTCCTCTTGTTCTCCTGACGGG - Intergenic
1158323340 18:56287698-56287720 TGCCCTTTTCACCTCCTGACTGG + Intergenic
1159938319 18:74386272-74386294 AGCCCTTTTCTGCCCATGCCAGG + Intergenic
1160794834 19:940520-940542 TGGCCTCTTCTACTCCTGCCTGG - Intronic
1161623125 19:5309778-5309800 ACCCCTCCTCTGCCCCTGCCTGG + Intronic
1163054204 19:14706149-14706171 ACTCCAGTTCTGCTCCTGACAGG + Intronic
1165148474 19:33747633-33747655 AGCCCTCTCCTGCTCCTGCCGGG - Intronic
1166061920 19:40331232-40331254 AGCCCTCTTCTGCTGCTTTTAGG + Intronic
1166466059 19:43031872-43031894 AGCCCTCTAGTGCCCCTGTCTGG + Intronic
925909743 2:8565947-8565969 AGCCCTCTTGTGCATCTGCCGGG - Intergenic
928137660 2:28700276-28700298 AACCCTCTTCTGCTTCAGCCAGG + Intergenic
930021122 2:47002847-47002869 AGCCCACTTCTGCTTCTGGCTGG + Intronic
935679038 2:105620274-105620296 AGGTCTCTTCTGCTGCTGCCAGG + Intergenic
937333359 2:121045640-121045662 AGACCCCCTCTGCTCCCGACAGG + Intergenic
939134070 2:138273423-138273445 CGCCCATTGCTGCTCCTGACTGG - Intergenic
943809912 2:192172034-192172056 AGCTCTCTTCAGCTGCAGACTGG - Intronic
945441780 2:209888064-209888086 AGCACTCATGTGCTCCTCACTGG + Intronic
946426964 2:219604148-219604170 AGCCCCCTTAAGCTCCTGCCTGG - Intronic
946448177 2:219757567-219757589 AGCCCTCTGCTACTCCTGGAGGG + Intergenic
946773338 2:223111933-223111955 AGCCCAACTCTGATCCTGACAGG - Intronic
1169978274 20:11354862-11354884 TGTCCTGTTCTGCTCCTGACTGG - Intergenic
1174578593 20:51555097-51555119 AGCCATCTTCATCTCCTGCCTGG + Intronic
1177414810 21:20780053-20780075 TGGCCTCTTCTGCTCCTGTGTGG - Intergenic
1178105827 21:29318230-29318252 AGCCATCATCAGCTCCTGCCTGG - Intronic
1178482482 21:32991571-32991593 AGACCTCGTCTGCCCCTGAGTGG + Intergenic
1178614316 21:34117330-34117352 GGCCCTCTTTCCCTCCTGACGGG + Intronic
1178681619 21:34677043-34677065 AGCCCTTTTCTCCTCCCCACAGG + Intronic
1179473216 21:41625955-41625977 AGGCCCTGTCTGCTCCTGACTGG - Intergenic
1182265792 22:29114183-29114205 AGCCCTCTTCCTCTCCTTATGGG - Intronic
1182942347 22:34288873-34288895 AGCCCTGTTTTTCTCCTGAGTGG - Intergenic
1183784414 22:40021321-40021343 AACCTCCTCCTGCTCCTGACAGG + Exonic
1184977216 22:48070890-48070912 AGGCCTCTTCTGTTGCTGGCTGG + Intergenic
950415720 3:12868110-12868132 AGCCCTCTAGTGGTCCTGGCCGG - Intronic
950902423 3:16510089-16510111 ACCCCTCTTATTGTCCTGACTGG - Intronic
951043480 3:18013319-18013341 TGCCCTCTTCTGCACCAGGCTGG - Intronic
951303559 3:21028549-21028571 TGCCCTCTTCAGCTCCTGTGGGG - Intergenic
951688874 3:25374558-25374580 AGCTCCCTGCTGCTCCTAACTGG + Intronic
951989598 3:28662037-28662059 GACCCTCTTCTGCCCCTGTCTGG - Intergenic
953636867 3:44671440-44671462 GGACCTGTTCTGCTTCTGACTGG + Intergenic
955531235 3:59875110-59875132 AGCACTCTTCTCCTCTGGACAGG - Intronic
956484392 3:69706672-69706694 TGTTCTCTTCTCCTCCTGACAGG - Intergenic
956669710 3:71675193-71675215 ATCCCTCTTCTACTTCTTACTGG - Intergenic
960046754 3:113205961-113205983 AGCCCTCATTTGCTCTTGACTGG - Intergenic
961613652 3:128161529-128161551 AGCCCTCCTCAGCTCTTGGCAGG - Intronic
967194272 3:187012968-187012990 AGCCCTCTGCAGCCCCTGCCTGG - Intronic
967389143 3:188938488-188938510 CGCCCACTGCTGCTCCTGATCGG - Intergenic
969250945 4:5968408-5968430 AGCCGTCTTCTGGTAGTGACCGG + Intronic
972226885 4:37023811-37023833 AGCCCAGTTCTGCTCCTAGCTGG - Intergenic
973540710 4:51932555-51932577 AGCCCTTTTCTGCTTAAGACTGG + Intergenic
974308289 4:60171450-60171472 ATCCCCATTCTGCTCCTGGCAGG - Intergenic
976705030 4:88011072-88011094 GGCCCTCTTCACCTCCTTACTGG - Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
979589093 4:122457802-122457824 ATCCTTCTTCTGCCCCTTACTGG - Intergenic
984832872 4:183991916-183991938 AGCCCAGTTCTGCTCCTCACTGG - Intronic
985860527 5:2467032-2467054 AGGGCGCTCCTGCTCCTGACTGG + Intergenic
985871494 5:2560969-2560991 ACCCCTCTTCTGCTCCATTCTGG - Intergenic
986305250 5:6509503-6509525 ACCCCTCTCCTGCTCCTCCCCGG + Intergenic
994959499 5:106580451-106580473 AGCCCTATCCTGCTCCTGGTTGG - Intergenic
997213182 5:132089785-132089807 AGCCCTCTTATACCCCTGAAGGG - Intergenic
997676088 5:135714293-135714315 AGCCCTCATCTGCTTCTGTCTGG - Intergenic
1001056697 5:168455535-168455557 GGCCCTCTTCTGCTCCCCTCAGG + Intronic
1003532730 6:6951740-6951762 AGGCCCCTTCTGCTCCTGACAGG + Intergenic
1004157310 6:13181701-13181723 AGCTCTCATCTGCACCTAACAGG - Intronic
1004649396 6:17593940-17593962 AGCCATCTTTTGATCCTAACAGG + Intergenic
1006410674 6:33871577-33871599 AGCCATCTTCTCCACCTGTCTGG + Intergenic
1009717164 6:67412609-67412631 TGCTGTCTTCTGTTCCTGACTGG - Intergenic
1012539455 6:100344111-100344133 AGTCCTTTTCTGCTCCTGCTTGG + Intergenic
1014292164 6:119571164-119571186 AGCCCTCTGATTCTCCTGCCGGG + Intergenic
1016372592 6:143390671-143390693 AGCCCGCTTCTCATCCTTACTGG + Intergenic
1018380257 6:163252448-163252470 AGCCCTCTCCGGCCCCTGCCTGG - Intronic
1019053268 6:169200952-169200974 AGCCCCACTCTGCTCCTGAGAGG + Intergenic
1019109306 6:169697289-169697311 AGCCCTCTGGTGGTCCTGTCTGG - Intronic
1020245170 7:6424051-6424073 AGCCCTCTTCTGCTCCTGACTGG - Intronic
1021191503 7:17625340-17625362 TGCACACTTCTGCTCCTAACTGG + Intergenic
1023519026 7:41032386-41032408 AGCAATCTTCTGCTTCTCACTGG - Intergenic
1025294845 7:57769244-57769266 ATCTCTCTTCTGCTCCTGGGTGG + Intergenic
1028994601 7:97086058-97086080 TGCCATCCTCTGCTCCTGGCGGG - Intergenic
1029015773 7:97314167-97314189 AGCCCTCTTCCCCTCCTTGCAGG - Intergenic
1031544919 7:123039457-123039479 AGCCCTCTTCTGCTCTCCAGTGG - Intergenic
1035435474 7:158856406-158856428 GGTCCTCTGCTGCTCCTGCCTGG + Intergenic
1035535814 8:390746-390768 AGCCCTGTGCTGTTCCTGGCTGG + Intergenic
1036659687 8:10700016-10700038 GGTCCTCATCTTCTCCTGACTGG - Intronic
1036848451 8:12185443-12185465 AGCCCGCTTGTGCTCCCGGCAGG + Exonic
1036869811 8:12427724-12427746 AGCCCGCTTGTGCTCCCGGCAGG + Exonic
1037165469 8:15822765-15822787 AGCTCTCATCTGCTGCTGATAGG + Intergenic
1045268793 8:100644205-100644227 AGCCCTCCCCTCCTACTGACGGG + Intronic
1046915541 8:119674600-119674622 CCCCCTCTTCTTCTCCTGGCTGG - Intergenic
1048976036 8:139673736-139673758 GGCCCTCTTCTGCTGCAGTCAGG + Intronic
1049280875 8:141743556-141743578 ACCCGTCATCTGCTCCTGTCTGG - Intergenic
1049360444 8:142210277-142210299 AGCCTCCTGCTGCTCCAGACAGG + Intergenic
1049447699 8:142638965-142638987 AGCCCTCCTCTCCTGCTGTCTGG - Intergenic
1052825486 9:33171026-33171048 CGCCCTCTTCTGCACCTGCCAGG + Intergenic
1053286529 9:36852840-36852862 GGCCCTGCTCTGTTCCTGACTGG - Intronic
1053326986 9:37162493-37162515 AGCCCTCCTCCACTCCTGAAGGG - Intronic
1055430679 9:76240138-76240160 AGCTCTCTTCAGCACCAGACCGG - Intronic
1055526102 9:77135401-77135423 TGCCCTCTTCTCCTTCTGAGTGG - Intergenic
1056998616 9:91487335-91487357 AGCCCTTTGCTTCTCCTCACTGG - Intergenic
1058129248 9:101231110-101231132 ACCCCTCTTCTGCTGCTAAATGG - Intronic
1058587520 9:106526296-106526318 AGCCCTCTACTGCTACTTCCAGG + Intergenic
1059756637 9:117299897-117299919 ATCCCTCTACAGCACCTGACTGG + Intronic
1060040886 9:120300007-120300029 TGCCTTCTTCTGGGCCTGACTGG + Intergenic
1060236759 9:121869243-121869265 AGCCCTCTGCTATTCCTGACAGG - Intronic
1060483698 9:124033655-124033677 GGCCCTTTTCTGCTCCTGGCTGG + Intergenic
1060649613 9:125314054-125314076 ATCTCTCTTCTGCTACTGCCTGG - Intronic
1061847223 9:133394536-133394558 AGCCCTCTTCTCCACCTGCGAGG + Intronic
1061908167 9:133709262-133709284 AGGCCTCTGCTGCCCCTGAGTGG + Intronic
1062211082 9:135364443-135364465 AGCCCTCATCAGCCCCTGGCAGG - Intergenic
1062354682 9:136156451-136156473 AGCCCTCTCCTCCTCCTGGGGGG + Intergenic
1186346382 X:8697309-8697331 AGCCCTATTCTGATTCTCACTGG - Intronic
1187193751 X:17060936-17060958 AGCACCCCGCTGCTCCTGACTGG - Intronic
1189733785 X:44048949-44048971 AGCCCTCCTCTGCTGTTCACTGG - Intergenic
1189897244 X:45668293-45668315 AGGTCTCTTCTGCTCATGAGAGG - Intergenic
1190756341 X:53405135-53405157 TGCCTTCATCTGCTCCTGAAGGG + Exonic
1192429219 X:71101286-71101308 AGCACCCTTCTCCTGCTGACAGG - Exonic