ID: 1020246595

View in Genome Browser
Species Human (GRCh38)
Location 7:6434162-6434184
Sequence TTCCATACTGAGATGAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020246595 Original CRISPR TTCCATACTGAGATGAGGTA AGG (reversed) Intronic
902899552 1:19505105-19505127 GTCCACACTGGGATGAGGGATGG - Intergenic
908371791 1:63488947-63488969 TTCCATATTGAAATTAAGTATGG - Intronic
910267676 1:85356656-85356678 TTCAAAACTGAGATGATGTTGGG - Intronic
912987359 1:114447410-114447432 TGCCAAACTGAGATGAGGAAAGG + Intronic
916397345 1:164405496-164405518 TTTATTTCTGAGATGAGGTAAGG + Intergenic
919885639 1:201932238-201932260 GTCCATACTGAGAGTAGGTAAGG + Intronic
921472804 1:215568080-215568102 CTCTAATCTGAGATGAGGTAAGG - Intronic
921574447 1:216818282-216818304 TTAAATACTGAGAAGAGCTAAGG + Intronic
924926239 1:248684571-248684593 TTCCATTCTGGGATAAAGTAGGG - Intergenic
1063699021 10:8366487-8366509 TTCCCAACTGAGAAGAGATAAGG - Intergenic
1064436445 10:15314965-15314987 TACCATTCTGATATGAGGAAAGG - Intronic
1067558457 10:47288150-47288172 TTCCATCCTGAGTTGGGGTGGGG - Intergenic
1071070340 10:81684492-81684514 TTCCAATTTGAGATGAGATATGG - Intergenic
1079538466 11:21543453-21543475 TTCCATACTGAGGTGGTGTCTGG - Intronic
1079968166 11:27004125-27004147 TTCCATACTGAGATTACTTGGGG - Intergenic
1081662340 11:44895777-44895799 GTCCAGACGGAGATGAGGCAGGG + Intronic
1083951153 11:65957088-65957110 TTCCATTCTGAGATGATGGACGG + Intronic
1085281848 11:75336084-75336106 TGCCAGACTGAGATGAGACAGGG - Intronic
1086231100 11:84570751-84570773 TTCTAAACTGAGATGATGAAGGG - Intronic
1094827056 12:34277702-34277724 TTCCATTCAGAGATGAGAGACGG - Intergenic
1096496222 12:52040826-52040848 CTTCAGACTGAGATGAGGTCTGG - Intronic
1096558965 12:52422481-52422503 TTCCATGCTGAGGTGAGATAAGG - Intergenic
1101664225 12:106795559-106795581 TTGCATAATAAGATGAGGTTGGG - Intronic
1101960781 12:109248184-109248206 TTCCATAGTCAGATGAGTTTGGG + Intronic
1108792104 13:53982841-53982863 TTAAATACTGAGATGTGGTAAGG + Intergenic
1109526512 13:63582451-63582473 TTCTATACTTAGAATAGGTATGG - Intergenic
1110542013 13:76717321-76717343 TTCCAGACACAGATGAGCTATGG - Intergenic
1112746637 13:102534247-102534269 TTGGATACTCAGAAGAGGTACGG - Intergenic
1115732218 14:36283419-36283441 CTCCAAACTGAGATGATGCATGG + Intergenic
1118266559 14:64300389-64300411 TTTTAGACTGAGATGAGGGAGGG - Intronic
1118404462 14:65410218-65410240 ATCCACACTGAGAAGAGGCAGGG + Intergenic
1118449811 14:65889852-65889874 TTCCATAGTGAGAGGGGGAAGGG + Intergenic
1119157071 14:72421272-72421294 AGCCATACGGAGATGAGGTGTGG + Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124434526 15:29635910-29635932 TTCCACATTCTGATGAGGTAAGG + Intergenic
1126039984 15:44580871-44580893 TTCCAGAAAGAGAGGAGGTAGGG + Intronic
1126242498 15:46461317-46461339 TTACAGGCTGAGATGAGGTCAGG - Intergenic
1126814308 15:52439562-52439584 TTTAAGACTGAGATAAGGTAAGG + Intronic
1127138570 15:55950457-55950479 TTCCTTACTGAAATCAAGTATGG + Intronic
1127231946 15:57006212-57006234 TTCCATGTTGAGATTAGATAAGG + Intronic
1127695028 15:61437288-61437310 TCTCATACTGACATGAGGAAAGG - Intergenic
1129032982 15:72631670-72631692 TTCCAAACTGAGATGAAGTGAGG + Intergenic
1129216901 15:74105559-74105581 TTCCAAACTGAGATGAAGTGAGG - Intronic
1130547822 15:84869401-84869423 CTCCATACTGAAAGGAGGTGGGG + Exonic
1131463518 15:92636870-92636892 TTCCAGAGTGTGATGAGGGAGGG - Intronic
1132274472 15:100554630-100554652 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274501 15:100554772-100554794 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274515 15:100554842-100554864 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274534 15:100554949-100554971 TTCCAGACGCAGATGAGGAACGG + Intergenic
1132274548 15:100555021-100555043 TTCCAGACGCAGATGAGGGATGG + Intergenic
1132274585 15:100555197-100555219 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274598 15:100555268-100555290 TTCCAGACGCAGATGAGGAACGG + Intergenic
1132274621 15:100555375-100555397 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274652 15:100555518-100555540 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274659 15:100555554-100555576 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274673 15:100555625-100555647 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274680 15:100555660-100555682 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274702 15:100555768-100555790 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274725 15:100555875-100555897 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274748 15:100555982-100556004 TTCCAGACGCAGATGAGGGAGGG + Intergenic
1132274761 15:100556053-100556075 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274775 15:100556124-100556146 TTCCAGACGCAGATGAGGAACGG + Intergenic
1132274834 15:100556409-100556431 TTCCAGACGCAGATGAGGAACGG + Intergenic
1132274861 15:100556552-100556574 TTCCAGACGCAGATGAGGAACGG + Intergenic
1132274890 15:100556694-100556716 TTCCAGACGCAGATGAGGAACGG + Intergenic
1132274914 15:100556802-100556824 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274921 15:100556838-100556860 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274934 15:100556909-100556931 TTCCAGACGCAGATGAGGAACGG + Intergenic
1132274983 15:100557158-100557180 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274990 15:100557194-100557216 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274997 15:100557230-100557252 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275011 15:100557301-100557323 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275018 15:100557337-100557359 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275031 15:100557408-100557430 TTCCAGACGCAGATGAGGAACGG + Intergenic
1132275067 15:100557586-100557608 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275074 15:100557622-100557644 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275081 15:100557658-100557680 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275095 15:100557729-100557751 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275102 15:100557765-100557787 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275130 15:100557907-100557929 TTCCAGACGCAGATGAGGAAAGG + Intergenic
1132275144 15:100557979-100558001 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275165 15:100558086-100558108 TTCCAGACGCAGATGAGGGATGG + Intergenic
1132275180 15:100558194-100558216 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132461776 16:58968-58990 TGCCATACCGAGCAGAGGTAAGG - Exonic
1133582997 16:7164709-7164731 TTCTATACAGCCATGAGGTAGGG - Intronic
1138457439 16:57129450-57129472 CTGCTTACTGAGATGAGGAACGG + Intronic
1140699501 16:77568186-77568208 TTTGACACTGAGATGAGTTAGGG - Intergenic
1143249802 17:5514802-5514824 TTCCATAATGAGGTGAGGATGGG + Exonic
1145763750 17:27443768-27443790 CTCCATGCTGAGATGGGATAAGG + Intergenic
1150410405 17:64936937-64936959 AACCATGCTGAGATGAGGGAGGG + Intergenic
1156127498 18:33924584-33924606 TTACATACTGGGATGAGGGTAGG - Intronic
1156363328 18:36403498-36403520 TTCCATTCTGAGAGCATGTATGG - Intronic
1156370321 18:36467029-36467051 GTCCAAACTGAGATGGGGCAGGG - Intronic
1156464888 18:37342556-37342578 TTCCAGTCTGGGATGAGGAAGGG - Intronic
1157336076 18:46738540-46738562 TGCAAAACTGAGATGAGGTGAGG - Intronic
1159568960 18:70090490-70090512 TTACATAAAGAGATGAGGTGAGG + Intronic
1162887309 19:13705186-13705208 TTGCAGACTGTGAAGAGGTAAGG - Intergenic
1164758690 19:30710507-30710529 TCCCAGCCTGAGATGAGGAACGG + Intronic
926613525 2:14971701-14971723 TGCCACACTGAGATGATGTTGGG + Intergenic
927890625 2:26745879-26745901 TTCCAAAGTGAGATGAGGCTGGG - Intergenic
928363385 2:30683577-30683599 TTACAAACTGAGATGAGATTTGG + Intergenic
930517690 2:52429242-52429264 GTTAATACTGAGATGGGGTAGGG + Intergenic
932614455 2:73223177-73223199 TTCAAGACTGGGATGGGGTAGGG + Intronic
936596220 2:113850822-113850844 TTTCACAATGAGATGAGATAAGG + Intergenic
938780771 2:134582822-134582844 CTCCATCCTGAGAGGAGGAAAGG + Intronic
939946431 2:148416774-148416796 TTGGATACTCAGATGAGGGAGGG - Intronic
945067749 2:205961386-205961408 TTCCCTACTGATATGAGCTGGGG - Intergenic
948657081 2:239483184-239483206 TTCCACACTGAGATGAGCCTGGG + Intergenic
1172902772 20:38346921-38346943 ATCGGTACTGAGATGAGGAAGGG + Intronic
1175704875 20:61169178-61169200 CCCCATACTGAGGTGGGGTAGGG + Intergenic
950922253 3:16706265-16706287 TTCCATACTAAAATAAGGGAAGG + Intergenic
952883774 3:38000829-38000851 TGCCATGCAGAGGTGAGGTAAGG + Intronic
953167475 3:40478027-40478049 TTCCATACTCAGAACAGATATGG + Intronic
953242476 3:41161862-41161884 CTCAATTCTGGGATGAGGTAGGG + Intergenic
958866394 3:99506461-99506483 TTCCAAAATGAAATGAGGTTGGG - Intergenic
962772717 3:138628085-138628107 CTCCACCCTGAGATGAGCTATGG + Intronic
964698930 3:159541566-159541588 TTCCATGCTGAGATTTGATATGG - Intronic
965339891 3:167476819-167476841 TTCAATACTTACATGAGGGATGG + Intronic
965661969 3:171051623-171051645 TTCTATACTGAAATAAGGTCTGG + Intergenic
969719214 4:8883820-8883842 TTTGATAATGAGATTAGGTAAGG - Intergenic
970716930 4:18937285-18937307 TTACCTACTGAGATTAGGCAGGG - Intergenic
971694328 4:29878943-29878965 TTTCAAACTGAGATAATGTAAGG - Intergenic
972843064 4:42954232-42954254 TCCCATAGTGCGATGAGGGAAGG + Intronic
975647828 4:76563104-76563126 TTCCATACTGAGTTGCTATAAGG + Intronic
983013400 4:162579030-162579052 TTCCAATCTGAGATGAGATTTGG - Intergenic
984563002 4:181292987-181293009 TTTTATACTGCGAGGAGGTACGG - Intergenic
985119839 4:186629500-186629522 TTCCATAATGAAAAGACGTATGG + Intronic
986171738 5:5319974-5319996 TACCATCCTGAGAAGAGTTATGG + Exonic
986171867 5:5320873-5320895 TACCATCCTGAGAAGAGTTATGG + Intergenic
987461202 5:18212892-18212914 TTCCATATGGAGATAAGGTTTGG - Intergenic
988685991 5:33526184-33526206 TTCCAACCTGAGAAGAGGTGAGG + Exonic
992134762 5:73733343-73733365 TTCCATTTTCAGATGAGGAAAGG + Intronic
993575461 5:89594122-89594144 TCCTAAACTGAGATGAGGAAAGG + Intergenic
1002844274 6:932910-932932 TTCCTTAAAGAGATGAGGAAAGG + Intergenic
1004697156 6:18044240-18044262 TTCCTTACTGTGATAAGGTGGGG + Intergenic
1004972060 6:20921583-20921605 TTAGACACTGAGATGAGGTTGGG - Intronic
1006464335 6:34182731-34182753 TTACATAGTGAGATGATGGATGG - Intergenic
1009929903 6:70164625-70164647 TTCCACACTGAGATGAGCTTTGG + Intronic
1015964402 6:138683619-138683641 TCCCATACTCAGATGAGGCCAGG - Intronic
1017696218 6:157019027-157019049 TCCAATAATGAGTTGAGGTAAGG + Intronic
1018712564 6:166507149-166507171 TTCCATCCTGGGAAGAGGGAGGG - Intronic
1019422797 7:958836-958858 TTCCAAACAGAGATGGGGTCTGG + Intronic
1020246595 7:6434162-6434184 TTCCATACTGAGATGAGGTAAGG - Intronic
1020393611 7:7687514-7687536 TTCCAGTCTGAGTTGAGGGAAGG - Intronic
1023128784 7:36981618-36981640 TTCCATACTGAGTTGAGAGAGGG + Intronic
1032892956 7:136219503-136219525 TTCCACACTGGGATGAGATCTGG - Intergenic
1034539186 7:151745224-151745246 TTGCATAATGAGATGTGGTTTGG - Intronic
1037288395 8:17325070-17325092 CTCCATAAAGACATGAGGTACGG + Intronic
1039326892 8:36495500-36495522 TTCCAAGCTTAGATGAGGTTCGG - Intergenic
1041437529 8:57858886-57858908 TGCAATAATAAGATGAGGTATGG + Intergenic
1042607592 8:70561667-70561689 ATCCATTGTGAAATGAGGTATGG - Intergenic
1042730038 8:71922861-71922883 TTCCCTAGTGAGATGAGAAATGG - Intronic
1042747574 8:72123531-72123553 TTCCATCCTGACTTAAGGTAAGG - Intergenic
1046187976 8:110747705-110747727 TTCTATACTTAGGTGAGGAAAGG + Intergenic
1047115275 8:121834912-121834934 GTCCAAACTGAGCTGAGGGAAGG - Intergenic
1048094997 8:131282730-131282752 TCCTATACTGAGTTGAGTTATGG + Intergenic
1048770048 8:137885597-137885619 ATCCATAGTGAGCTGAGGCAGGG - Intergenic
1055984114 9:82038440-82038462 TTTCCCACTGAGCTGAGGTAAGG + Intergenic
1057794772 9:98147313-98147335 TTGCATACTGACATGTGGTAGGG + Intronic
1058094568 9:100844968-100844990 TGAGAAACTGAGATGAGGTATGG - Intergenic
1187284190 X:17887077-17887099 TTCCCTACTGGGATGATGTCAGG + Intergenic
1187542187 X:20207927-20207949 TTCCTTACAGAGAAGTGGTAAGG + Intronic
1188491258 X:30740845-30740867 TTGCATAATAAGATGAGGTGGGG + Intergenic
1192098080 X:68234382-68234404 TTCCCTGCTGAGACGGGGTATGG + Intronic
1192362819 X:70450009-70450031 TGCCATCCTGAGATGAGTAAGGG - Intronic
1192432781 X:71123981-71124003 TTCCTTTCTGAGATGATGTGTGG + Intronic
1200411497 Y:2866334-2866356 TTCAATACTGAGAAGAAGAATGG - Intronic