ID: 1020248246

View in Genome Browser
Species Human (GRCh38)
Location 7:6447439-6447461
Sequence CAGCGCCGAGACCTGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020248246_1020248252 10 Left 1020248246 7:6447439-6447461 CCCAGGGCCAGGTCTCGGCGCTG 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1020248252 7:6447472-6447494 GGTGCTCGCGTCCTGCTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020248246 Original CRISPR CAGCGCCGAGACCTGGCCCT GGG (reversed) Intronic
900371434 1:2333948-2333970 CAGCGTCCAGACCTGGCTCTGGG - Intronic
900550019 1:3250032-3250054 CAGCGCTGGGCCGTGGCCCTGGG + Intronic
901205947 1:7496033-7496055 CAGCCCAGAGAGCTGGCCCTGGG - Intronic
901214902 1:7549863-7549885 AAGCGCCCAGGCTTGGCCCTGGG + Intronic
903673103 1:25047966-25047988 CAGAGGCTGGACCTGGCCCTTGG - Intergenic
904991110 1:34593393-34593415 CAGCTCCCAGCCCTGTCCCTTGG - Intergenic
906509974 1:46405367-46405389 CAGCGTGGAGTCCTGGCCCTGGG - Exonic
906910504 1:49943880-49943902 CACAGCCGAGAACTTGCCCTAGG - Intronic
912528959 1:110306361-110306383 CTGAGCCCAGAGCTGGCCCTAGG + Intergenic
922618075 1:226974742-226974764 CAGCGCCTTGGCCTGGCACTGGG + Intronic
923171444 1:231421475-231421497 CACCGCCGAGCCCTGGCCGCCGG + Exonic
1069605319 10:69735364-69735386 CTTAGCCCAGACCTGGCCCTGGG + Intergenic
1070103857 10:73413936-73413958 CAGCGCCCAGAGCTGGCCGAGGG + Intronic
1070594329 10:77821636-77821658 CAGCGGCGGGACCTGGCCCAAGG - Exonic
1075101865 10:119511796-119511818 CAGCACCGAGGCCTGAGCCTGGG - Intronic
1076110521 10:127856008-127856030 GAGCCCCGAGACCTGCTCCTGGG - Intergenic
1076241001 10:128907345-128907367 CAGCACAGAGACCTGGCCTCTGG + Intergenic
1076657914 10:132036767-132036789 CAGCGCAGAGGCCCGGCCCCCGG - Intergenic
1076715931 10:132363703-132363725 CAGGGCCGGGGCCAGGCCCTGGG - Intronic
1076904468 10:133355262-133355284 CAGCTCCCAGACCTGGGCCCTGG - Exonic
1077094266 11:792681-792703 CTGGGCCGAGAGCTGGCCCTGGG + Exonic
1077408070 11:2391472-2391494 CAGGGCCCTCACCTGGCCCTGGG - Intronic
1077414800 11:2420066-2420088 GAGCACCGAGACCTGGGCCGTGG - Intronic
1077592452 11:3503142-3503164 CAGAGCTGAGATATGGCCCTCGG - Intergenic
1078578155 11:12518379-12518401 GAGCCCCAGGACCTGGCCCTGGG - Intronic
1081416606 11:42822773-42822795 CAGAGCCAGGACTTGGCCCTGGG - Intergenic
1081993960 11:47352009-47352031 CAGCCCAGGGACCTGGGCCTGGG - Intronic
1083035601 11:59634660-59634682 CAGCCACTATACCTGGCCCTGGG - Intergenic
1083309926 11:61778941-61778963 CAGCCCCGGGATCTGCCCCTCGG - Intronic
1084248287 11:67875865-67875887 CAGAGCTGAGATATGGCCCTCGG - Intergenic
1084411009 11:69005877-69005899 CAGCGCCGAGCGCTGCGCCTCGG - Exonic
1090832316 11:130428167-130428189 CAGCTCCGAGGCCTGCCCCCCGG + Exonic
1091650335 12:2304571-2304593 CAGCTCCATGACCTGGCCCCAGG + Intronic
1091678588 12:2510046-2510068 CATCGCTGAGCCCTGGCCCCTGG + Intronic
1095310602 12:40692894-40692916 CAGCGCCGGGAACTCGCCCCAGG + Intronic
1096139926 12:49234515-49234537 CAGCGCCAGGGCCTGGGCCTGGG + Intronic
1103892676 12:124251637-124251659 GAGCCACGATACCTGGCCCTAGG - Intronic
1107263076 13:38518775-38518797 CAGCCCATGGACCTGGCCCTGGG + Intergenic
1108359978 13:49660050-49660072 CAGCACATAGACCAGGCCCTTGG - Intergenic
1109150614 13:58843328-58843350 CAGGGCTGAGAACTGGCCCCAGG - Intergenic
1109423729 13:62146148-62146170 CAGGGCCCAGGCCTGGCCCCTGG + Intergenic
1111096054 13:83517008-83517030 CAGCTCCTAGTGCTGGCCCTCGG - Intergenic
1112501747 13:99948237-99948259 GAGGGCTGGGACCTGGCCCTGGG + Intergenic
1117055095 14:51904155-51904177 CACAGCCGACACCTGACCCTGGG + Intronic
1118352445 14:64982907-64982929 CAGGACTGAGACCTGGCCCTTGG + Intronic
1118824070 14:69364594-69364616 CTGAGCTGAGACATGGCCCTGGG - Intergenic
1118896807 14:69952255-69952277 AAGTGCCGAGACCCGACCCTGGG + Exonic
1121183547 14:91947619-91947641 CAGCGCCGAGCACTGGGCCCTGG - Exonic
1121410830 14:93747123-93747145 GAGGGCCAAGGCCTGGCCCTGGG + Intronic
1121417418 14:93788764-93788786 CGGCGGCCAGCCCTGGCCCTGGG - Intergenic
1121645305 14:95514354-95514376 CAGCACTGAAAGCTGGCCCTTGG - Intergenic
1121897646 14:97663395-97663417 CAGTGCACAGTCCTGGCCCTGGG - Intergenic
1122341039 14:101028651-101028673 CAGAGCCGCAGCCTGGCCCTGGG + Intergenic
1122750407 14:103928633-103928655 CAGCGCCAGGACGTGGCCCCCGG + Exonic
1122917214 14:104864887-104864909 CAGCCCCGCGCCCTGGCCCAGGG - Intergenic
1126849248 15:52787586-52787608 CAGCGCCCAGGCCTGAGCCTTGG - Intronic
1128300720 15:66564886-66564908 CAGCCCAGAGTCCTGGCTCTGGG - Intronic
1128755397 15:70180390-70180412 TAGCTCCGAGGCCTGGCCCAGGG + Intergenic
1128978416 15:72169416-72169438 CAGCGCCGGGGCCTGGCCACAGG + Intronic
1129034270 15:72640239-72640261 CAGAGCCGGGACGTGGCCCTCGG + Intergenic
1129215612 15:74096977-74096999 CAGAGCCGGGACGTGGCCCTCGG - Intergenic
1129331206 15:74828304-74828326 CAGCACAAAGCCCTGGCCCTTGG - Intronic
1129409188 15:75339461-75339483 TAGAGCTGGGACCTGGCCCTGGG + Intronic
1129732748 15:77941306-77941328 CAGAGCCGGGACGTGGCCCTCGG - Intergenic
1130948255 15:88565744-88565766 AAGCCCCAAGACCTGGCCCAGGG + Intergenic
1131132257 15:89907963-89907985 CAGAGCCCAGGCCAGGCCCTAGG - Intronic
1131367588 15:91853497-91853519 CAGCCCCAAGGCCTGGGCCTGGG - Intergenic
1133031859 16:3014819-3014841 CATAGCTGGGACCTGGCCCTGGG + Exonic
1133103613 16:3493697-3493719 CAGCGCCCAGGCCTGGGCCTCGG - Exonic
1133125344 16:3642559-3642581 CAGCACCGAGAGCAGGGCCTGGG - Intronic
1134043308 16:11084063-11084085 CAGCCCCGCGGCCTGGCTCTGGG + Intronic
1134061418 16:11201888-11201910 CAGAGAGGGGACCTGGCCCTGGG + Intergenic
1134463981 16:14456767-14456789 CAGTGAGGAGAGCTGGCCCTAGG - Intronic
1136061233 16:27728117-27728139 CAGCGCCCAGACCCTGCCATGGG - Intronic
1138507733 16:57486505-57486527 CAGCGGCGAGACCTGGCGGAGGG - Intronic
1138535407 16:57657362-57657384 CACCGAGGAGACCTGGCCCCAGG - Exonic
1139430940 16:66910759-66910781 CAGGACAGAGAGCTGGCCCTGGG - Intronic
1142373953 16:89697333-89697355 CAGCCCCGGGGCCCGGCCCTAGG - Exonic
1143447458 17:7017899-7017921 CACCGCCGAGGCTTGGCCCTGGG - Intergenic
1143676391 17:8436094-8436116 CGGCGCCGAGGCCTGCCCTTGGG + Intronic
1144454434 17:15407338-15407360 CAGTGGAGAGACCTGGGCCTAGG - Intergenic
1146159963 17:30554419-30554441 GAGCGACTACACCTGGCCCTAGG - Intergenic
1147119483 17:38327505-38327527 CAAGGCTGAGACCTGTCCCTGGG - Exonic
1149510085 17:57233751-57233773 CATCCCCAGGACCTGGCCCTTGG - Intergenic
1151758600 17:76088400-76088422 CACCACAGTGACCTGGCCCTGGG - Intronic
1151908666 17:77066689-77066711 CAGAGCCCAAAACTGGCCCTGGG - Intergenic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152362005 17:79837177-79837199 CAGCGCCCACCCCAGGCCCTTGG + Intronic
1152718646 17:81911697-81911719 CACCGCCCACACCTGGCGCTCGG + Intergenic
1152760935 17:82106706-82106728 CAGTGCAGAGTCCTGGCCCAAGG - Intronic
1153220350 18:2855353-2855375 CAGGGCCGAGACTGGGGCCTTGG + Intronic
1160872499 19:1283600-1283622 CGTCTCCGAGGCCTGGCCCTGGG - Intergenic
1160919787 19:1513961-1513983 CAGGGATGAGACCAGGCCCTGGG + Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161792437 19:6368469-6368491 CAGGACCCAGACCTGGCCCTGGG + Intronic
1162804255 19:13128863-13128885 CAGTGCCTAGTCCTGGCCCTGGG - Intronic
1163158561 19:15452004-15452026 CACCGCCCAGACCTGCCCCAGGG + Intronic
1163264154 19:16208170-16208192 CACCGCCCAGGCCTGGCCCCAGG - Intronic
1165110017 19:33496871-33496893 CAGGGCCCAGACCAGGCCCGAGG + Intronic
1165357682 19:35313743-35313765 CTGCCCCCACACCTGGCCCTGGG + Exonic
1165757733 19:38304170-38304192 GAGCGCTGAGACCTGCCCGTTGG - Exonic
1166049295 19:40248529-40248551 CAGTGCCTAGAACAGGCCCTTGG + Intronic
1166561998 19:43739039-43739061 CAGAGCAGAGCCCTGGCTCTGGG - Intronic
1166705896 19:44907840-44907862 CAGCGCTGGGAACTGGCACTGGG + Exonic
1167178488 19:47883108-47883130 CAGAGCCCAGTCCTGGCCCCGGG + Intronic
1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG + Exonic
1167569278 19:50276845-50276867 CAGCGCCACGGCCAGGCCCTGGG + Exonic
925537781 2:4935440-4935462 CAGTCCCGAGCCCTGCCCCTCGG + Intergenic
926625269 2:15085440-15085462 CAGCACTGAGAGGTGGCCCTGGG - Intergenic
927131791 2:20066362-20066384 CAGCACCCAGCCCTGGACCTGGG + Intergenic
927645848 2:24876590-24876612 CAGGGCCCTGAGCTGGCCCTAGG + Intronic
932880730 2:75499572-75499594 CAGGTCCAAGACCTGACCCTTGG - Intronic
937828981 2:126399586-126399608 CAGAGCTGAGAACTTGCCCTAGG + Intergenic
938032724 2:128009185-128009207 CAGCCACCACACCTGGCCCTGGG - Intronic
941402243 2:165045093-165045115 CAGGGCTGAGAACTTGCCCTAGG + Intergenic
945242026 2:207685104-207685126 CAGTGCCGAAACCAGGGCCTGGG - Intergenic
947715146 2:232335564-232335586 CAGCCCCCACCCCTGGCCCTTGG + Intronic
947734221 2:232446515-232446537 CAGCCCCCACCCCTGGCCCTTGG + Intergenic
1171777420 20:29382163-29382185 CAGCTCAGAGACCTACCCCTAGG - Intergenic
1172788463 20:37486152-37486174 CATCTCCTAGACCTGGCCTTTGG + Intergenic
1172791119 20:37506139-37506161 CATCTCCTAGACCTGGCCTTTGG - Intronic
1174561272 20:51432398-51432420 CAGGGCTGAGCTCTGGCCCTGGG + Exonic
1178895553 21:36554228-36554250 CACCGCCGAGCCCAGGGCCTGGG - Intronic
1179630388 21:42674395-42674417 CTCTGCCGAGTCCTGGCCCTTGG + Intronic
1180009911 21:45042805-45042827 CAGCGCAGGGTCCTGGCCTTGGG + Intergenic
1180080855 21:45486965-45486987 CAGCGGGGAGTCCTGGTCCTGGG - Exonic
1180087030 21:45512280-45512302 CAGCGAGGAGGCCTGGCCCGTGG - Exonic
1181125125 22:20697678-20697700 CAGAGGCCAGGCCTGGCCCTGGG - Intergenic
1183082275 22:35464121-35464143 CAGCACCGAGATCTGGTCCCAGG - Intergenic
1184472148 22:44702160-44702182 GGGCGCCGAGACCCGCCCCTGGG + Intronic
1184711125 22:46250116-46250138 CTGCGCCGACTCCTGGCGCTTGG + Intronic
1185235733 22:49711860-49711882 CAGGGCCCAAACCTGGCCTTGGG - Intergenic
1203215774 22_KI270731v1_random:4958-4980 CAGAGTCCAGGCCTGGCCCTGGG + Intergenic
950101257 3:10358370-10358392 CAGCCCCTACACCTGTCCCTTGG + Intronic
950576182 3:13833454-13833476 CAAAGCTGAGACCTGGCCCCAGG - Intronic
951294470 3:20917399-20917421 CAGGGCTGAGAACTTGCCCTAGG - Intergenic
954778797 3:53045103-53045125 CAGCGCCCCGACCTGCCGCTCGG - Intronic
960516502 3:118608080-118608102 CAGGGCTGAGAACTTGCCCTAGG - Intergenic
960742961 3:120855256-120855278 AAGCGCCCAGGCCTGTCCCTTGG - Intergenic
964382972 3:156116308-156116330 CGGCGCTGAGACCAGGCCATTGG - Intronic
965566846 3:170128819-170128841 CTGCACCAAAACCTGGCCCTGGG + Exonic
967162127 3:186748152-186748174 CAGAGCCTAGACCTAACCCTTGG - Intergenic
968473768 4:793513-793535 CTGCGGGGAGCCCTGGCCCTCGG + Intronic
968514899 4:1011828-1011850 CCGCCCCGAGACCGGGCCCGGGG + Intronic
969609011 4:8216769-8216791 CAGAGCTGGGACCTCGCCCTGGG + Intronic
970560472 4:17277057-17277079 CAGAGCCGAAGCCTGGGCCTCGG + Intergenic
976479673 4:85525960-85525982 CAGCTCTGAGAACAGGCCCTTGG - Intronic
984973333 4:185209649-185209671 CAGCGCCGCCACCAGGCGCTGGG - Intronic
985592862 5:774466-774488 TAGGGCCGGGACCTGTCCCTTGG + Intergenic
985743546 5:1633903-1633925 CAGCGGCGGGCCTTGGCCCTTGG - Intergenic
994180735 5:96763255-96763277 CAAAGCCCAGACCTGGCCCCGGG + Intronic
994887412 5:105582474-105582496 CAGTGCTGAGATCTTGCCCTAGG - Intergenic
998295306 5:140964508-140964530 CAGCTCAGAGACCTGGCCACTGG - Intronic
999325022 5:150638604-150638626 CAGAGACCAGTCCTGGCCCTAGG + Intronic
1001858499 5:175033112-175033134 CAGCTGCCAGGCCTGGCCCTGGG + Intergenic
1006411320 6:33875557-33875579 GAGGGCCGAGGGCTGGCCCTGGG + Intergenic
1008038816 6:46774834-46774856 CAGTCCCGAGCCCTGCCCCTCGG - Intergenic
1015928680 6:138335013-138335035 CAGCGGGGAGTCCTGGCCCCTGG - Exonic
1017988781 6:159468449-159468471 CAGAGGAGAGAGCTGGCCCTAGG - Intergenic
1018624617 6:165765411-165765433 CAGTCCCGAGACCTGCCCCGCGG + Intronic
1019197083 6:170289325-170289347 CAGCGCGGACACCTCGCCCCGGG - Intronic
1019515471 7:1438072-1438094 GAGCGCCTCGGCCTGGCCCTGGG - Intronic
1019526987 7:1484920-1484942 CAGCACAGAGACCCTGCCCTGGG - Intronic
1019546734 7:1581137-1581159 GAGCCCCCAGACCTGGCCCTGGG - Intergenic
1019707644 7:2504108-2504130 CACTGCCGAGCCCTGGCCATGGG - Intergenic
1020248246 7:6447439-6447461 CAGCGCCGAGACCTGGCCCTGGG - Intronic
1022639365 7:32166789-32166811 CAGCGTCAAGACATGTCCCTGGG - Intronic
1024443869 7:49453883-49453905 CAGTCCCGAGCCCTGCCCCTCGG - Intergenic
1030878815 7:114850387-114850409 CTGCGGAGAGACCTGGCCTTAGG + Intergenic
1031166817 7:118239127-118239149 CATGGCCCAGACCTGGTCCTTGG + Intronic
1034158685 7:148976463-148976485 CAGCCTCTAGACCTGGTCCTTGG - Intergenic
1034426703 7:151017846-151017868 CAGAGCCGTTCCCTGGCCCTGGG - Intronic
1035171584 7:157020340-157020362 GAGTGCCGAGTCCTGGACCTGGG - Intergenic
1035702152 8:1644275-1644297 CAGAGCCGAGACGAGGCTCTTGG - Intronic
1036249953 8:7153301-7153323 CAGTTCCGAGACCTACCCCTAGG + Intergenic
1036454016 8:8892801-8892823 CAGCGCCGACCCCAGCCCCTCGG + Exonic
1036709516 8:11069132-11069154 CAGCCCAGAAACATGGCCCTAGG + Intronic
1042271600 8:66961705-66961727 CAGCGCCGAGCCCGCGCCCCTGG - Exonic
1049534299 8:143171036-143171058 CAGAGGCGAGACCTGGCTCTGGG + Intergenic
1056318533 9:85415019-85415041 AAGCCCAGAGTCCTGGCCCTTGG + Intergenic
1057311835 9:93947937-93947959 CAGCTCGGAGATCTGGCCCCGGG + Intergenic
1058154665 9:101501923-101501945 CAGCGTCGCCACCAGGCCCTGGG + Intronic
1058645947 9:107131544-107131566 CTGCCCCGTGACCAGGCCCTGGG + Intergenic
1059217699 9:112581552-112581574 CTGCACCCAGATCTGGCCCTGGG - Intronic
1061084778 9:128392577-128392599 CCGCGCTGAGCCCTGTCCCTGGG + Intergenic
1061227854 9:129291112-129291134 CCGCGCCTAGACCAGGCCCTGGG - Intergenic
1061370423 9:130194527-130194549 CAGAGCCGACACAGGGCCCTGGG - Intronic
1062014323 9:134283707-134283729 CAGTGCCGAGACCCTGTCCTTGG + Intergenic
1203775606 EBV:71446-71468 AAGCGCCGACACCTGCCCCCGGG - Intergenic
1189875675 X:45433703-45433725 CAGGGCCAAGACCTGGAACTAGG + Intergenic
1190626996 X:52346073-52346095 CAGCACTAAAACCTGGCCCTTGG - Intergenic
1190701033 X:52990043-52990065 CAGCACTAAAACCTGGCCCTAGG + Intronic
1199596934 X:149513408-149513430 CAGCCCAGAGCCCTGGCCCGTGG - Intronic
1201460952 Y:14223858-14223880 CAGCAAGGAGATCTGGCCCTCGG + Intergenic