ID: 1020248304 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:6447720-6447742 |
| Sequence | GACGGCGGCTACGGGGGCGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1770 | |||
| Summary | {0: 1, 1: 0, 2: 12, 3: 91, 4: 1666} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1020248304_1020248314 | 17 | Left | 1020248304 | 7:6447720-6447742 | CCACCGCCCCCGTAGCCGCCGTC | 0: 1 1: 0 2: 12 3: 91 4: 1666 |
||
| Right | 1020248314 | 7:6447760-6447782 | ACGACCAGCTCGAAGAACCCTGG | 0: 1 1: 0 2: 0 3: 4 4: 41 |
||||
| 1020248304_1020248315 | 18 | Left | 1020248304 | 7:6447720-6447742 | CCACCGCCCCCGTAGCCGCCGTC | 0: 1 1: 0 2: 12 3: 91 4: 1666 |
||
| Right | 1020248315 | 7:6447761-6447783 | CGACCAGCTCGAAGAACCCTGGG | 0: 1 1: 0 2: 0 3: 1 4: 36 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1020248304 | Original CRISPR | GACGGCGGCTACGGGGGCGG TGG (reversed) | Intronic | ||