ID: 1020248304

View in Genome Browser
Species Human (GRCh38)
Location 7:6447720-6447742
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1770
Summary {0: 1, 1: 0, 2: 12, 3: 91, 4: 1666}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020248304_1020248314 17 Left 1020248304 7:6447720-6447742 CCACCGCCCCCGTAGCCGCCGTC 0: 1
1: 0
2: 12
3: 91
4: 1666
Right 1020248314 7:6447760-6447782 ACGACCAGCTCGAAGAACCCTGG 0: 1
1: 0
2: 0
3: 4
4: 41
1020248304_1020248315 18 Left 1020248304 7:6447720-6447742 CCACCGCCCCCGTAGCCGCCGTC 0: 1
1: 0
2: 12
3: 91
4: 1666
Right 1020248315 7:6447761-6447783 CGACCAGCTCGAAGAACCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020248304 Original CRISPR GACGGCGGCTACGGGGGCGG TGG (reversed) Intronic