ID: 1020248352

View in Genome Browser
Species Human (GRCh38)
Location 7:6447940-6447962
Sequence CTCAAGCGCAAACGCAGCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 24}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020248343_1020248352 14 Left 1020248343 7:6447903-6447925 CCAGCACCCTCCGGACGCCGCCA 0: 1
1: 0
2: 0
3: 8
4: 177
Right 1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 24
1020248348_1020248352 -3 Left 1020248348 7:6447920-6447942 CCGCCACCAAATTATCGGCGCTC 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 24
1020248344_1020248352 8 Left 1020248344 7:6447909-6447931 CCCTCCGGACGCCGCCACCAAAT 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 24
1020248350_1020248352 -9 Left 1020248350 7:6447926-6447948 CCAAATTATCGGCGCTCAAGCGC 0: 1
1: 0
2: 0
3: 0
4: 6
Right 1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 24
1020248345_1020248352 7 Left 1020248345 7:6447910-6447932 CCTCCGGACGCCGCCACCAAATT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 24
1020248346_1020248352 4 Left 1020248346 7:6447913-6447935 CCGGACGCCGCCACCAAATTATC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 24
1020248341_1020248352 25 Left 1020248341 7:6447892-6447914 CCGAGAACAAACCAGCACCCTCC 0: 1
1: 0
2: 2
3: 26
4: 419
Right 1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 24
1020248349_1020248352 -6 Left 1020248349 7:6447923-6447945 CCACCAAATTATCGGCGCTCAAG 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020248352 Original CRISPR CTCAAGCGCAAACGCAGCGA GGG Exonic
917049004 1:170897100-170897122 CTCAAGCGCAAAGGCACATAAGG + Intergenic
921797853 1:219368539-219368561 CCCAAGCAAAAACACAGCGAAGG + Intergenic
1062874955 10:935579-935601 CTCAAGGGCAGAGGCAGCGAGGG + Intergenic
1073755915 10:106580357-106580379 CTCAAGGGGAAACTCAGGGAGGG - Intronic
1077499032 11:2900821-2900843 CGCAAGGGGAAGCGCAGCGAGGG + Intronic
1078799128 11:14624989-14625011 CTCAAGCCCAACTGCAGCAATGG + Intronic
1096389700 12:51218516-51218538 CCCCAGCGCCAAAGCAGCGAAGG + Intergenic
1102292903 12:111715470-111715492 ATCAAGCACAAACGCAGCCATGG - Intronic
1117411397 14:55454601-55454623 CTCCAGCAAAAACGCTGCGAGGG - Intronic
1121123109 14:91388754-91388776 CTCAAGCACACTTGCAGCGAGGG + Intronic
1125968165 15:43890880-43890902 CTCAAGCTCAAACTCAGTGGGGG + Intronic
1128668373 15:69555295-69555317 TTCAAGTACAAACGCAGCCACGG - Intergenic
1143951179 17:10633549-10633571 CTCAGGCGCAGATGCAGCCATGG - Intronic
1149650183 17:58271712-58271734 CTGAAGCGCAAAGGCCGCGTGGG - Exonic
1160403853 18:78630848-78630870 GTCAAACGTAAACACAGCGAGGG + Intergenic
1166740786 19:45113696-45113718 CTCAGGGACAAAGGCAGCGATGG - Intronic
947076482 2:226350897-226350919 CTCAAGTCCAAATGCAGAGATGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1173481940 20:43408497-43408519 CTCCAGCGAAAAAGCAGAGAAGG + Intergenic
951591279 3:24267786-24267808 CTCAACCCCAAAAGCAGCGTGGG - Intronic
986280595 5:6318919-6318941 CTCAAGGGCAGAAGCAGTGAGGG - Intergenic
996570504 5:124928485-124928507 CTGAAGAGCAACTGCAGCGATGG - Intergenic
998312619 5:141150795-141150817 CTCACCCGCAATCGCAGCGAAGG + Exonic
998315398 5:141178578-141178600 CTCACCCGCAAACGCAGTGATGG + Exonic
998319326 5:141214667-141214689 CTCACCCGCAAACGCAGTGATGG + Exonic
1007718349 6:43870202-43870224 CTGAAGGGCAAAGGCAGCCATGG + Intergenic
1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG + Exonic
1027516539 7:79148643-79148665 CTCAAGCACAAACACATCCATGG - Intronic
1029838813 7:103340986-103341008 CTCAAGCGCTAATGCTGGGAAGG + Intronic
1035583515 8:755103-755125 CTCAAGGCCAAACCCAGTGAGGG - Intergenic