ID: 1020253004

View in Genome Browser
Species Human (GRCh38)
Location 7:6484192-6484214
Sequence TGCCCCGCGCGCGCGCGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 177}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020253004_1020253010 -2 Left 1020253004 7:6484192-6484214 CCGGCGCGCGCGCGCGCGGGGCA 0: 1
1: 0
2: 3
3: 25
4: 177
Right 1020253010 7:6484213-6484235 CACCCTGGGAGAGCGGGGCCAGG 0: 1
1: 1
2: 1
3: 49
4: 377
1020253004_1020253013 14 Left 1020253004 7:6484192-6484214 CCGGCGCGCGCGCGCGCGGGGCA 0: 1
1: 0
2: 3
3: 25
4: 177
Right 1020253013 7:6484229-6484251 GGCCAGGCCCCGCCCCTTAAAGG 0: 1
1: 0
2: 0
3: 11
4: 146
1020253004_1020253016 16 Left 1020253004 7:6484192-6484214 CCGGCGCGCGCGCGCGCGGGGCA 0: 1
1: 0
2: 3
3: 25
4: 177
Right 1020253016 7:6484231-6484253 CCAGGCCCCGCCCCTTAAAGGGG 0: 1
1: 0
2: 4
3: 18
4: 159
1020253004_1020253017 17 Left 1020253004 7:6484192-6484214 CCGGCGCGCGCGCGCGCGGGGCA 0: 1
1: 0
2: 3
3: 25
4: 177
Right 1020253017 7:6484232-6484254 CAGGCCCCGCCCCTTAAAGGGGG 0: 1
1: 0
2: 1
3: 8
4: 140
1020253004_1020253008 -8 Left 1020253004 7:6484192-6484214 CCGGCGCGCGCGCGCGCGGGGCA 0: 1
1: 0
2: 3
3: 25
4: 177
Right 1020253008 7:6484207-6484229 GCGGGGCACCCTGGGAGAGCGGG 0: 1
1: 0
2: 2
3: 38
4: 283
1020253004_1020253007 -9 Left 1020253004 7:6484192-6484214 CCGGCGCGCGCGCGCGCGGGGCA 0: 1
1: 0
2: 3
3: 25
4: 177
Right 1020253007 7:6484206-6484228 CGCGGGGCACCCTGGGAGAGCGG 0: 1
1: 0
2: 2
3: 21
4: 222
1020253004_1020253009 -7 Left 1020253004 7:6484192-6484214 CCGGCGCGCGCGCGCGCGGGGCA 0: 1
1: 0
2: 3
3: 25
4: 177
Right 1020253009 7:6484208-6484230 CGGGGCACCCTGGGAGAGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 280
1020253004_1020253014 15 Left 1020253004 7:6484192-6484214 CCGGCGCGCGCGCGCGCGGGGCA 0: 1
1: 0
2: 3
3: 25
4: 177
Right 1020253014 7:6484230-6484252 GCCAGGCCCCGCCCCTTAAAGGG 0: 1
1: 0
2: 1
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020253004 Original CRISPR TGCCCCGCGCGCGCGCGCGC CGG (reversed) Exonic