ID: 1020257219

View in Genome Browser
Species Human (GRCh38)
Location 7:6508990-6509012
Sequence CATCCACGATGGTGACCCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020257214_1020257219 -8 Left 1020257214 7:6508975-6508997 CCGGGGTCAGGAAATCATCCACG 0: 1
1: 0
2: 0
3: 2
4: 97
Right 1020257219 7:6508990-6509012 CATCCACGATGGTGACCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1020257206_1020257219 14 Left 1020257206 7:6508953-6508975 CCCACCTCCTCGTAGTCGTTCTC 0: 1
1: 0
2: 0
3: 14
4: 75
Right 1020257219 7:6508990-6509012 CATCCACGATGGTGACCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1020257207_1020257219 13 Left 1020257207 7:6508954-6508976 CCACCTCCTCGTAGTCGTTCTCC 0: 1
1: 0
2: 2
3: 46
4: 830
Right 1020257219 7:6508990-6509012 CATCCACGATGGTGACCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1020257205_1020257219 26 Left 1020257205 7:6508941-6508963 CCTGCTTGCGTGCCCACCTCCTC 0: 1
1: 0
2: 2
3: 31
4: 254
Right 1020257219 7:6508990-6509012 CATCCACGATGGTGACCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1020257209_1020257219 10 Left 1020257209 7:6508957-6508979 CCTCCTCGTAGTCGTTCTCCGGG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1020257219 7:6508990-6509012 CATCCACGATGGTGACCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1020257212_1020257219 7 Left 1020257212 7:6508960-6508982 CCTCGTAGTCGTTCTCCGGGGTC 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1020257219 7:6508990-6509012 CATCCACGATGGTGACCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020257219 Original CRISPR CATCCACGATGGTGACCCGG GGG Exonic
903041874 1:20536814-20536836 CATTCACGATGCTGGCCTGGGGG - Intergenic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
906675532 1:47690747-47690769 CTTCCACTATGCTGTCCCGGTGG - Intergenic
912578265 1:110695522-110695544 CATCAAACATGGTGACCCTGAGG + Intergenic
912993337 1:114510539-114510561 CATCCAGCAAGGTGAGCCGGAGG - Exonic
920345709 1:205304448-205304470 CATCCTCCAGGGTGGCCCGGCGG + Exonic
1070772459 10:79090324-79090346 CATCCCCCATGGGGACCTGGAGG + Intronic
1072664696 10:97384752-97384774 CAGCCAGGATGGAGACCCTGAGG + Intronic
1075203781 10:120428748-120428770 CATCCATGATGGGGACGGGGGGG + Intergenic
1079395212 11:20056289-20056311 CTGCCAAGATGGTGAGCCGGTGG - Intronic
1081736170 11:45405994-45406016 CCTCCATGATGGTGAACTGGAGG - Intergenic
1081808744 11:45903672-45903694 CACCCAGGAGGGTGACCAGGAGG + Intronic
1106483810 13:30155701-30155723 CATCCAAGGTGGTGCCCGGGTGG + Intergenic
1119768749 14:77207085-77207107 CAGCCATGATGGTGCCCAGGGGG - Intronic
1131099032 15:89673619-89673641 CACCCCGGATGGTGACCAGGAGG - Intronic
1132980236 16:2735044-2735066 CGTCCACGATGGTGACAGAGTGG + Intergenic
1133883599 16:9805804-9805826 CTTCCCCGATGGGTACCCGGTGG - Intronic
1136747513 16:32604757-32604779 CACCCAGGATGGTGTCCCAGTGG + Intergenic
1138079702 16:54078002-54078024 CATCCATGCTGGTGACAAGGGGG + Intronic
1141428354 16:83957719-83957741 CACCCACAATGATGACCGGGAGG - Exonic
1141510260 16:84507261-84507283 CAGCCACAATGGGGGCCCGGTGG - Intronic
1203049648 16_KI270728v1_random:863962-863984 CACCCAGGATGGTGTCCCAGTGG + Intergenic
1143901764 17:10179798-10179820 CACCCAAAATGGTGACCAGGAGG + Intronic
1152365803 17:79855658-79855680 CAGCCTTGATGGTGACCCTGGGG + Intergenic
1152628936 17:81400937-81400959 CATGTACCAGGGTGACCCGGCGG - Intronic
1158679451 18:59553801-59553823 CCACCACTATGGCGACCCGGAGG + Intronic
1166569030 19:43781991-43782013 CATCCAGGATGATGCCCTGGGGG + Intergenic
1166994515 19:46713878-46713900 CATCCAGGAGGGCGACCTGGTGG - Exonic
1167510956 19:49895165-49895187 CCTCCAGGATGGTGACCTGAGGG + Exonic
926847686 2:17160116-17160138 CATCCAGGATGGTCACCTGCTGG - Intergenic
928392164 2:30918475-30918497 TGTTCACGATGGTGACCAGGGGG + Intronic
931139355 2:59439739-59439761 CAGACACGATAGTGAGCCGGTGG + Intergenic
932462266 2:71890397-71890419 CATCCACAATGGTGTCGCAGAGG + Intergenic
940797741 2:158098408-158098430 CATCCAAGATGGTGAGGGGGAGG + Intronic
1174632519 20:51970256-51970278 CAACCACTATGGGGACCCAGAGG + Intergenic
1179916593 21:44481717-44481739 CATGCACGAGAGTGACCAGGTGG - Intergenic
966944609 3:184769075-184769097 CATCCACGCCGGTGTCCTGGGGG - Intergenic
968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG + Intergenic
982044795 4:151433289-151433311 GATCTAGGATGGTGACCCTGGGG + Intronic
998476514 5:142426871-142426893 CATCCACAATAGTGACCTGCTGG + Intergenic
1006255524 6:32829438-32829460 CATCCAGGATGAGGACCCGCGGG + Exonic
1020257219 7:6508990-6509012 CATCCACGATGGTGACCCGGGGG + Exonic
1026310660 7:69181065-69181087 CATCCAGGCTGCTGACCTGGGGG - Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1034030650 7:147759413-147759435 CCTCCACAATGGTAAACCGGAGG - Intronic
1048866837 8:138767705-138767727 CAGCCAGGATGGAGACCGGGCGG - Intronic
1058909138 9:109505161-109505183 CTTCCCCCATGGTGACCTGGTGG - Intergenic
1200116034 X:153770106-153770128 CATCCAGGATGGGCAGCCGGGGG - Exonic