ID: 1020264892

View in Genome Browser
Species Human (GRCh38)
Location 7:6553707-6553729
Sequence GGCTCCAAAAAGCCCTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020264892_1020264900 26 Left 1020264892 7:6553707-6553729 CCTACAGAGGGCTTTTTGGAGCC No data
Right 1020264900 7:6553756-6553778 AGAGAGAACGGTCTTTCTGTGGG No data
1020264892_1020264899 25 Left 1020264892 7:6553707-6553729 CCTACAGAGGGCTTTTTGGAGCC No data
Right 1020264899 7:6553755-6553777 GAGAGAGAACGGTCTTTCTGTGG No data
1020264892_1020264897 14 Left 1020264892 7:6553707-6553729 CCTACAGAGGGCTTTTTGGAGCC No data
Right 1020264897 7:6553744-6553766 ACTTTGGTCCTGAGAGAGAACGG No data
1020264892_1020264894 -2 Left 1020264892 7:6553707-6553729 CCTACAGAGGGCTTTTTGGAGCC No data
Right 1020264894 7:6553728-6553750 CCCCTGCAGAGTTGATACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020264892 Original CRISPR GGCTCCAAAAAGCCCTCTGT AGG (reversed) Intergenic
No off target data available for this crispr