ID: 1020264894

View in Genome Browser
Species Human (GRCh38)
Location 7:6553728-6553750
Sequence CCCCTGCAGAGTTGATACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020264892_1020264894 -2 Left 1020264892 7:6553707-6553729 CCTACAGAGGGCTTTTTGGAGCC No data
Right 1020264894 7:6553728-6553750 CCCCTGCAGAGTTGATACTTTGG No data
1020264890_1020264894 7 Left 1020264890 7:6553698-6553720 CCTTTGTGTCCTACAGAGGGCTT No data
Right 1020264894 7:6553728-6553750 CCCCTGCAGAGTTGATACTTTGG No data
1020264887_1020264894 25 Left 1020264887 7:6553680-6553702 CCAATCACTGTATCTCAGCCTTT No data
Right 1020264894 7:6553728-6553750 CCCCTGCAGAGTTGATACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020264894 Original CRISPR CCCCTGCAGAGTTGATACTT TGG Intergenic
No off target data available for this crispr