ID: 1020264895

View in Genome Browser
Species Human (GRCh38)
Location 7:6553729-6553751
Sequence ACCAAAGTATCAACTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020264895_1020264900 4 Left 1020264895 7:6553729-6553751 CCCTGCAGAGTTGATACTTTGGT No data
Right 1020264900 7:6553756-6553778 AGAGAGAACGGTCTTTCTGTGGG No data
1020264895_1020264897 -8 Left 1020264895 7:6553729-6553751 CCCTGCAGAGTTGATACTTTGGT No data
Right 1020264897 7:6553744-6553766 ACTTTGGTCCTGAGAGAGAACGG No data
1020264895_1020264902 20 Left 1020264895 7:6553729-6553751 CCCTGCAGAGTTGATACTTTGGT No data
Right 1020264902 7:6553772-6553794 CTGTGGGTCCGTTGGCTGTATGG No data
1020264895_1020264901 12 Left 1020264895 7:6553729-6553751 CCCTGCAGAGTTGATACTTTGGT No data
Right 1020264901 7:6553764-6553786 CGGTCTTTCTGTGGGTCCGTTGG No data
1020264895_1020264899 3 Left 1020264895 7:6553729-6553751 CCCTGCAGAGTTGATACTTTGGT No data
Right 1020264899 7:6553755-6553777 GAGAGAGAACGGTCTTTCTGTGG No data
1020264895_1020264904 30 Left 1020264895 7:6553729-6553751 CCCTGCAGAGTTGATACTTTGGT No data
Right 1020264904 7:6553782-6553804 GTTGGCTGTATGGACGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020264895 Original CRISPR ACCAAAGTATCAACTCTGCA GGG (reversed) Intergenic
No off target data available for this crispr