ID: 1020264896

View in Genome Browser
Species Human (GRCh38)
Location 7:6553730-6553752
Sequence GACCAAAGTATCAACTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020264896_1020264904 29 Left 1020264896 7:6553730-6553752 CCTGCAGAGTTGATACTTTGGTC No data
Right 1020264904 7:6553782-6553804 GTTGGCTGTATGGACGTCAAAGG No data
1020264896_1020264900 3 Left 1020264896 7:6553730-6553752 CCTGCAGAGTTGATACTTTGGTC No data
Right 1020264900 7:6553756-6553778 AGAGAGAACGGTCTTTCTGTGGG No data
1020264896_1020264902 19 Left 1020264896 7:6553730-6553752 CCTGCAGAGTTGATACTTTGGTC No data
Right 1020264902 7:6553772-6553794 CTGTGGGTCCGTTGGCTGTATGG No data
1020264896_1020264901 11 Left 1020264896 7:6553730-6553752 CCTGCAGAGTTGATACTTTGGTC No data
Right 1020264901 7:6553764-6553786 CGGTCTTTCTGTGGGTCCGTTGG No data
1020264896_1020264899 2 Left 1020264896 7:6553730-6553752 CCTGCAGAGTTGATACTTTGGTC No data
Right 1020264899 7:6553755-6553777 GAGAGAGAACGGTCTTTCTGTGG No data
1020264896_1020264897 -9 Left 1020264896 7:6553730-6553752 CCTGCAGAGTTGATACTTTGGTC No data
Right 1020264897 7:6553744-6553766 ACTTTGGTCCTGAGAGAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020264896 Original CRISPR GACCAAAGTATCAACTCTGC AGG (reversed) Intergenic
No off target data available for this crispr