ID: 1020264897

View in Genome Browser
Species Human (GRCh38)
Location 7:6553744-6553766
Sequence ACTTTGGTCCTGAGAGAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020264896_1020264897 -9 Left 1020264896 7:6553730-6553752 CCTGCAGAGTTGATACTTTGGTC No data
Right 1020264897 7:6553744-6553766 ACTTTGGTCCTGAGAGAGAACGG No data
1020264895_1020264897 -8 Left 1020264895 7:6553729-6553751 CCCTGCAGAGTTGATACTTTGGT No data
Right 1020264897 7:6553744-6553766 ACTTTGGTCCTGAGAGAGAACGG No data
1020264893_1020264897 -7 Left 1020264893 7:6553728-6553750 CCCCTGCAGAGTTGATACTTTGG No data
Right 1020264897 7:6553744-6553766 ACTTTGGTCCTGAGAGAGAACGG No data
1020264892_1020264897 14 Left 1020264892 7:6553707-6553729 CCTACAGAGGGCTTTTTGGAGCC No data
Right 1020264897 7:6553744-6553766 ACTTTGGTCCTGAGAGAGAACGG No data
1020264890_1020264897 23 Left 1020264890 7:6553698-6553720 CCTTTGTGTCCTACAGAGGGCTT No data
Right 1020264897 7:6553744-6553766 ACTTTGGTCCTGAGAGAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020264897 Original CRISPR ACTTTGGTCCTGAGAGAGAA CGG Intergenic
No off target data available for this crispr