ID: 1020264899

View in Genome Browser
Species Human (GRCh38)
Location 7:6553755-6553777
Sequence GAGAGAGAACGGTCTTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020264892_1020264899 25 Left 1020264892 7:6553707-6553729 CCTACAGAGGGCTTTTTGGAGCC No data
Right 1020264899 7:6553755-6553777 GAGAGAGAACGGTCTTTCTGTGG No data
1020264896_1020264899 2 Left 1020264896 7:6553730-6553752 CCTGCAGAGTTGATACTTTGGTC No data
Right 1020264899 7:6553755-6553777 GAGAGAGAACGGTCTTTCTGTGG No data
1020264893_1020264899 4 Left 1020264893 7:6553728-6553750 CCCCTGCAGAGTTGATACTTTGG No data
Right 1020264899 7:6553755-6553777 GAGAGAGAACGGTCTTTCTGTGG No data
1020264895_1020264899 3 Left 1020264895 7:6553729-6553751 CCCTGCAGAGTTGATACTTTGGT No data
Right 1020264899 7:6553755-6553777 GAGAGAGAACGGTCTTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020264899 Original CRISPR GAGAGAGAACGGTCTTTCTG TGG Intergenic
No off target data available for this crispr