ID: 1020265590

View in Genome Browser
Species Human (GRCh38)
Location 7:6557845-6557867
Sequence TCCACAGAGAATGCCGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020265587_1020265590 0 Left 1020265587 7:6557822-6557844 CCAAAAGGGCGTGGGAATCCAGT No data
Right 1020265590 7:6557845-6557867 TCCACAGAGAATGCCGCAGTGGG No data
1020265586_1020265590 1 Left 1020265586 7:6557821-6557843 CCCAAAAGGGCGTGGGAATCCAG No data
Right 1020265590 7:6557845-6557867 TCCACAGAGAATGCCGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020265590 Original CRISPR TCCACAGAGAATGCCGCAGT GGG Intergenic
No off target data available for this crispr