ID: 1020267059

View in Genome Browser
Species Human (GRCh38)
Location 7:6567929-6567951
Sequence GTGTGTGGGGGGAAGGTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020267046_1020267059 27 Left 1020267046 7:6567879-6567901 CCTGCTGCTCTTCCCCTCAACAG No data
Right 1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG No data
1020267047_1020267059 15 Left 1020267047 7:6567891-6567913 CCCCTCAACAGTCATGCTAGAAT No data
Right 1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG No data
1020267049_1020267059 13 Left 1020267049 7:6567893-6567915 CCTCAACAGTCATGCTAGAATTA No data
Right 1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG No data
1020267048_1020267059 14 Left 1020267048 7:6567892-6567914 CCCTCAACAGTCATGCTAGAATT No data
Right 1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020267059 Original CRISPR GTGTGTGGGGGGAAGGTGAC GGG Intergenic
No off target data available for this crispr