ID: 1020268662

View in Genome Browser
Species Human (GRCh38)
Location 7:6578586-6578608
Sequence GAACCATGTCCGGCAGCTAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020268659_1020268662 -9 Left 1020268659 7:6578572-6578594 CCAGGCTCCTGGAAGAACCATGT 0: 1
1: 0
2: 1
3: 11
4: 217
Right 1020268662 7:6578586-6578608 GAACCATGTCCGGCAGCTACTGG 0: 1
1: 0
2: 0
3: 10
4: 56
1020268658_1020268662 -3 Left 1020268658 7:6578566-6578588 CCAGATCCAGGCTCCTGGAAGAA 0: 1
1: 0
2: 2
3: 24
4: 191
Right 1020268662 7:6578586-6578608 GAACCATGTCCGGCAGCTACTGG 0: 1
1: 0
2: 0
3: 10
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020268662 Original CRISPR GAACCATGTCCGGCAGCTAC TGG Exonic
901224686 1:7606301-7606323 GCATCATGGCCGGCAGCTGCTGG - Intronic
904585673 1:31579306-31579328 GAACCAAGTCTGTCAGCCACAGG - Intronic
914813707 1:151047972-151047994 GCCCCATGACCCGCAGCTACCGG + Exonic
1072455143 10:95568822-95568844 GAACCATGTCCTACAGCCAAAGG + Intergenic
1073218785 10:101852466-101852488 CCACCATGTCCGGCTGCTTCTGG - Intronic
1073851856 10:107630236-107630258 TAACCATGTCAGAAAGCTACTGG + Intergenic
1076888962 10:133274780-133274802 CCACCAGGTCCGGCAGCTGCTGG - Intronic
1084006125 11:66324626-66324648 GAGCCTTGTCTTGCAGCTACTGG + Intergenic
1084195100 11:67520065-67520087 GATCGGTGTCCGGGAGCTACGGG - Exonic
1085768471 11:79304644-79304666 GAACACTGTCCTGCAGCCACAGG + Intronic
1088711746 11:112514481-112514503 GAACCATGTGAGACAGCCACGGG - Intergenic
1095715789 12:45344672-45344694 AAACCATGTCGGGCATATACTGG + Intronic
1097346587 12:58499973-58499995 GCACCATGTCTGGCACATACAGG - Intergenic
1107480106 13:40779227-40779249 GTCCCGTGTCCGGGAGCTACAGG - Intergenic
1107689046 13:42933704-42933726 GAACCATGTCCTGCAGCTTTGGG + Intronic
1110616312 13:77546093-77546115 GAACCATGTCAGGCCACTTCAGG + Intronic
1121313386 14:92947029-92947051 TAGCCATGTCCCGCAGCTGCTGG - Intronic
1161170396 19:2809861-2809883 GAACCATGGCAGGCAGCCAACGG - Intronic
1162207338 19:9065706-9065728 GAGACATGTCCAGCAGCTCCAGG + Intergenic
1163789456 19:19297931-19297953 GAGCCATGTTCCGCACCTACTGG + Intronic
1164514060 19:28919117-28919139 GAAGCATGACTGGCAGCAACAGG + Intergenic
1165225247 19:34350203-34350225 GAACAAAGTGCGGCAGCAACTGG + Intronic
1165488854 19:36111633-36111655 GCACCAGGGCCGGCAGCCACAGG + Intronic
1167422431 19:49412196-49412218 GAACCATGTGAGGGACCTACTGG + Intronic
926125786 2:10270819-10270841 GGACCATGTCCTGCAGCCAGTGG + Intergenic
927753064 2:25687021-25687043 GACCCATGTCCTGCAGCTTTGGG + Intergenic
929590942 2:43145868-43145890 GCACCATGTCCCACAGCTTCAGG + Intergenic
938280485 2:130060496-130060518 GTACCTTGTCCGGCCGCTAGTGG - Intergenic
938280879 2:130062839-130062861 GTACCATGTCCGGCCGCTGGTGG - Intergenic
938281202 2:130064826-130064848 GTACCATGTCCGGCCGCTAGTGG - Intergenic
938331522 2:130451675-130451697 GTACCATGTCCGGCCGCTAGTGG - Intergenic
938357939 2:130666901-130666923 GTACCATGTCCGGCCGCTAGTGG + Intergenic
938358427 2:130669831-130669853 GTACCATGTCCGGCCGCTAGTGG + Intergenic
938434177 2:131272515-131272537 GTACCATGTCCGGCCGCTAGTGG + Intronic
938434499 2:131274505-131274527 GTACCATGTCCGGCCGCTAGTGG + Intronic
938434820 2:131276494-131276516 GTACCATGTCCGGCCGCTAGTGG + Intronic
941421286 2:165285615-165285637 TGACCTTGTCCGGCAGCCACAGG - Intronic
1170571150 20:17633459-17633481 GAAGCAGGTCCTGCAGCTGCAGG - Exonic
1170933665 20:20791886-20791908 GAGCACTGTCCGGAAGCTACCGG + Intergenic
1178699674 21:34822282-34822304 TAACCATGTCATGCACCTACAGG + Intronic
1180995711 22:19964269-19964291 GAAGCGTGTCCGGCAGGTACCGG - Exonic
1181426319 22:22843306-22843328 GATCAATGTCAGGGAGCTACTGG + Intronic
1182058389 22:27379079-27379101 GAAGCAGGTCCAGCAGCCACTGG + Intergenic
968601589 4:1512472-1512494 GGTCCATGGCCGGCAGCTCCAGG - Intergenic
969444801 4:7238786-7238808 GACCCCTGTCCGCCAGCTCCTGG + Intronic
972469550 4:39390640-39390662 GAAGCACGTCCGGCACCTTCAGG - Intergenic
979039153 4:115764719-115764741 GAAGCATGGCAGGCAGGTACAGG - Intergenic
979195202 4:117912966-117912988 AAACCAGGTCCTGTAGCTACTGG + Intergenic
987072642 5:14352293-14352315 GAAGCAGGTCTGGCAGCCACAGG - Intronic
1001396753 5:171423416-171423438 GAACAATGTCAGGCAGGTGCCGG - Intronic
1001629441 5:173163822-173163844 GAAGCTTGTCCGTCAGCTCCCGG - Exonic
1012759324 6:103278376-103278398 GAACCATGTAAGGCAACTTCTGG + Intergenic
1015215826 6:130749168-130749190 GCAGCATGACGGGCAGCTACAGG + Intergenic
1020268662 7:6578586-6578608 GAACCATGTCCGGCAGCTACTGG + Exonic
1028414865 7:90569027-90569049 TGGCCATGTCCTGCAGCTACAGG + Intronic
1030409548 7:109158185-109158207 GAACCATGTCTGGCAGGCAGAGG + Intergenic
1033040102 7:137909747-137909769 AAACCATATCAGGCAGCTATGGG - Intronic
1034829584 7:154297894-154297916 TAACCATGACAGGCAGCAACTGG - Intronic
1039183557 8:34892338-34892360 GAACCATCTGAGGCAGCTATTGG + Intergenic
1048873159 8:138815425-138815447 GAACCATGTCCTGCAGGGCCTGG - Intronic
1048975823 8:139672613-139672635 CAACCATGTCCCTCTGCTACAGG - Intronic
1050345253 9:4679752-4679774 GTTCCATGTCCGGCTGCTCCGGG - Exonic
1052916800 9:33929331-33929353 GAACCCTGTCAGGCAGCTAAGGG - Intronic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1055071405 9:72170224-72170246 GAACCAAGTGCGGTAGCTTCTGG + Intronic
1058157389 9:101530767-101530789 TAACCATATTCTGCAGCTACTGG - Intronic
1061438177 9:130579749-130579771 GCACCGGGTCCGGCAGGTACGGG + Exonic