ID: 1020269969

View in Genome Browser
Species Human (GRCh38)
Location 7:6589219-6589241
Sequence CTCTGACCTGTGTGATGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020269960_1020269969 30 Left 1020269960 7:6589166-6589188 CCTTGGTGTCTCTAAACTCTGGG 0: 1
1: 0
2: 1
3: 33
4: 349
Right 1020269969 7:6589219-6589241 CTCTGACCTGTGTGATGTGCAGG 0: 1
1: 1
2: 1
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020269969 Original CRISPR CTCTGACCTGTGTGATGTGC AGG Exonic
900986506 1:6076257-6076279 CTCTGCCCTGTGCCATGTGAGGG - Intronic
901602583 1:10433356-10433378 TTCTGTCCTCTGTGACGTGCAGG + Intronic
902634952 1:17729028-17729050 CTCTAATCTGTGTGATGTGCCGG - Intergenic
902994155 1:20210879-20210901 CTCTGACCTGTGTTACATGGGGG + Intergenic
904947774 1:34212188-34212210 CTCTCTTCTCTGTGATGTGCAGG + Exonic
910599384 1:89014509-89014531 CTCTGACCTTGGTGCTGTTCTGG + Intronic
910603698 1:89059279-89059301 CTCTGACCTTGGTGCTGTTCTGG + Intronic
910637135 1:89421205-89421227 CTCTGACCTTGGTGCTGTTCTGG - Intergenic
912434436 1:109650587-109650609 CTCTTTTCTGTGTGATTTGCAGG - Intergenic
913611341 1:120512545-120512567 CTCTTTCCTGTCTGATGAGCTGG - Intergenic
915194268 1:154177589-154177611 ATCTGAACTGGGTGGTGTGCGGG - Intronic
917648693 1:177054488-177054510 CTCTGACCTGTGCGTGGAGCAGG + Intronic
918209514 1:182338651-182338673 CTCTTCCCTGTTTGATGGGCTGG + Intergenic
920933829 1:210412718-210412740 TTCTGGCCTGGGTGATCTGCAGG - Intronic
922794632 1:228333960-228333982 CTCTGTCCTGACTGATGGGCAGG + Intronic
1063187836 10:3666471-3666493 CTCTGAGCTGGGTGAGCTGCAGG - Intergenic
1065768886 10:29058092-29058114 CCCAGACCTGTGTCCTGTGCCGG - Intergenic
1069875081 10:71557404-71557426 CTCTGACTTGTGTGGTGTTCTGG + Intronic
1070310008 10:75266240-75266262 CCTGGGCCTGTGTGATGTGCAGG + Intergenic
1070997286 10:80796914-80796936 CTCTGACTTTTGTGAAATGCAGG + Intergenic
1071466874 10:85949106-85949128 CTCTGACAGGTGTGGGGTGCGGG + Intronic
1072330502 10:94344716-94344738 GTGTGACTTTTGTGATGTGCGGG - Intronic
1073175635 10:101555184-101555206 GTCTGACCTGTGTGTTTTTCAGG - Exonic
1074288351 10:112119560-112119582 CCCTCACCTGTCTTATGTGCAGG + Intergenic
1075693115 10:124413825-124413847 CTCTGACTTATGTGATGGGGCGG - Intronic
1076343165 10:129763998-129764020 GGATGAGCTGTGTGATGTGCCGG + Intronic
1076913427 10:133403936-133403958 CTTTGGCCTGTCTGATGGGCGGG + Intronic
1077411028 11:2403993-2404015 CTGTCACCTGGGTGATGTGCTGG - Intergenic
1080422794 11:32126716-32126738 CTCTGACCTTTGTTATTTGTTGG + Intergenic
1083295772 11:61714788-61714810 CTCTGACCTTTGTTAGGTGTGGG + Intronic
1083713222 11:64561212-64561234 CTCTCACCTGTGCGCTGTGAAGG - Intronic
1083733182 11:64664542-64664564 CTCTGTCCCATGTGATCTGCAGG + Intronic
1084463073 11:69307028-69307050 CTCTGCCCACTGTGTTGTGCTGG - Intronic
1084700811 11:70785196-70785218 GTCTGTCCTGTGTGGTGTGCAGG - Intronic
1086011900 11:82114891-82114913 CTATTACATGTGGGATGTGCAGG + Intergenic
1087864707 11:103210208-103210230 TTCTGACCTGAGTGATTTGAAGG + Intronic
1088320984 11:108554517-108554539 TTGTGACCTGTGAAATGTGCAGG + Intronic
1088905376 11:114151524-114151546 GTCTGACCTGTGAGTTTTGCTGG - Intronic
1089566393 11:119373960-119373982 TTCTGACTTATGTGATGAGCAGG + Intronic
1090094611 11:123730450-123730472 TCCTGATCTGTGTGATGTGGAGG - Intronic
1090598902 11:128349206-128349228 CTGTGAACTGTGTGAAGAGCTGG - Intergenic
1090599063 11:128350961-128350983 CTGTGAACTGTGTGAAGAGCTGG - Intergenic
1092597553 12:10023872-10023894 CTGTGCCCTTTGTGATGTGGAGG + Intergenic
1092648278 12:10603641-10603663 ATTTGAACTGTGTGATGTGGTGG - Intergenic
1095902890 12:47346702-47346724 CTGTGAGCTCTGTGCTGTGCTGG + Intergenic
1100476322 12:94938949-94938971 CTCTGACCTGAGTGATGTGCTGG - Intronic
1103317885 12:120071731-120071753 CTCTGACAGGAGGGATGTGCTGG - Exonic
1103773120 12:123344225-123344247 CCCTGACCTGGCTGAGGTGCAGG - Intronic
1104971955 12:132534809-132534831 CTCTGACCTGCAGAATGTGCTGG - Intronic
1107281423 13:38739684-38739706 CTCCGTCCTGGGTGATGTGAGGG - Intronic
1109226434 13:59701514-59701536 CTCTGACCTATATGACGTGCTGG - Intronic
1116380237 14:44258669-44258691 CTCTGTTCTGCATGATGTGCAGG + Intergenic
1117951669 14:61089362-61089384 CCCTGCCTTGTGTCATGTGCAGG + Intergenic
1118615703 14:67573204-67573226 CTTGGACCTGTGTGATGTCTAGG + Intronic
1119024048 14:71138486-71138508 CTCAGCCCTGTGTGAGATGCAGG + Intergenic
1119545552 14:75469079-75469101 CACTGGCCTGTGTCATGTCCAGG - Intronic
1120706377 14:87750327-87750349 TCCTGACCTATGTGCTGTGCTGG + Intergenic
1121484769 14:94306154-94306176 CTATGACCTCGGAGATGTGCTGG - Exonic
1121611792 14:95285985-95286007 CTCTGACCTATGGGAAGTGGAGG + Intronic
1125800812 15:42445025-42445047 TTCTGAGCTGTGTGATGAGAGGG - Intronic
1126073153 15:44883470-44883492 CTGTGCCCTGTGTGTTGGGCAGG - Intergenic
1126085108 15:45004168-45004190 CTGTGCCCTGTGTGTTGGGCAGG + Intergenic
1126105987 15:45147500-45147522 CCCTGACCTGTGAGCTGAGCAGG + Exonic
1126582990 15:50258144-50258166 CTATGAGCTGTGTGATCTGGGGG + Intronic
1128885471 15:71282939-71282961 CTTTGACCTGTGAGGTGGGCAGG + Intronic
1128911423 15:71519111-71519133 CTCAGACCTGAGTGATATGAAGG + Intronic
1131293749 15:91129570-91129592 CTGTGCCCAGTGTGCTGTGCTGG - Intronic
1131423146 15:92324310-92324332 CTCTGTTCTCTTTGATGTGCTGG - Intergenic
1131644320 15:94325556-94325578 CTCTAACCTGGGTGGTGTGAGGG + Intronic
1131744483 15:95431766-95431788 CCATGACTTGTGTGAGGTGCTGG - Intergenic
1132834482 16:1945930-1945952 CTCTGACCTGTGTCCTCTGCAGG - Exonic
1133155102 16:3868775-3868797 CTCTGAGTTGTGTGGTGTGGTGG - Intronic
1133382222 16:5340981-5341003 CAGTGACCTGTGTGATATGAGGG + Intergenic
1134066240 16:11230253-11230275 CTCTGACCTCTGAGCTGTGAAGG - Intergenic
1135928307 16:26714782-26714804 TTCTGAGCTGTGTGATCTTCTGG - Intergenic
1136010531 16:27360658-27360680 TTCTGATCTGTGTGATGTCGAGG + Intronic
1137733672 16:50708726-50708748 CCCTGAGCTGTGTGTGGTGCTGG + Intronic
1139449385 16:67017533-67017555 CTCTGACCTGGGGGAAGGGCTGG + Intergenic
1141503869 16:84462292-84462314 CTCTAACGTGGGTGATGTGACGG + Intronic
1142966908 17:3587305-3587327 CTCTGACCTGTGAGATGTCGTGG + Intronic
1145122330 17:20271584-20271606 CCCTGACCCTTGTGATGTGTGGG - Intronic
1145175103 17:20693631-20693653 CCCTGACCCCTGTGATGTGTGGG - Intergenic
1146862878 17:36320235-36320257 CTCTTAGATGAGTGATGTGCAGG + Intronic
1147093207 17:38124318-38124340 CTCTCAGATGAGTGATGTGCAGG + Intergenic
1147104000 17:38196170-38196192 CTCTTAGATGAGTGATGTGCAGG - Intergenic
1147420635 17:40320622-40320644 CTCAGAACCGTGTGATGTGACGG + Intronic
1148052868 17:44777722-44777744 CTCTGACCTGAGCTATGTGGAGG + Exonic
1148425488 17:47592233-47592255 CTCTTAGATGAGTGATGTGCAGG + Intronic
1148457739 17:47820072-47820094 CTCTGAGCTGTGGGAGGTGGTGG - Exonic
1152483580 17:80573818-80573840 TTCTGATCTGTGGGATGTCCTGG - Intronic
1155032590 18:21997284-21997306 CTCTGCCCTGTCTCATGGGCTGG + Intergenic
1160122512 18:76143457-76143479 CTCTGGCCAGTGTGGTCTGCAGG + Intergenic
1160767253 19:814047-814069 CTCAGACCTGCCCGATGTGCTGG - Intronic
1161613771 19:5258208-5258230 CTCTGGCCTGTCTCCTGTGCTGG + Intronic
1161863987 19:6820785-6820807 CTTTGACCTCTTCGATGTGCAGG + Exonic
1165735738 19:38174334-38174356 CCCTGACGTGTGTCATGGGCTGG - Intronic
1167202074 19:48072861-48072883 CTCTCACCTCTGTGATGACCCGG - Intronic
1168097508 19:54124037-54124059 GGCTGACCTCTGTGATGTCCAGG - Intronic
1168309934 19:55455253-55455275 CTCTCACCTGCGTGAGGAGCAGG + Exonic
925953687 2:8939608-8939630 CTAGGACCTGTGTGGTGTGGAGG - Intronic
925988808 2:9237088-9237110 CTCTGACCTCTTGGCTGTGCGGG + Intronic
926328743 2:11807756-11807778 GTCAGGCCTGTGTGATTTGCAGG + Intronic
927515677 2:23670391-23670413 CGCCGACCGGTGTGATGGGCAGG + Intronic
929192345 2:39151142-39151164 CTCTGACCTGTAACATGAGCAGG + Intergenic
935250189 2:101253717-101253739 CACTGAGCTGTATGATGTGATGG - Intronic
938264351 2:129915757-129915779 CTCTGGACAGTGGGATGTGCAGG - Intergenic
938796517 2:134721858-134721880 CGCTCACCTTTGAGATGTGCTGG - Intergenic
948131211 2:235601874-235601896 CAGTGACCTGGGTGATGTGGTGG - Intronic
948773908 2:240270169-240270191 CTCTTACCTGTGTGGCCTGCTGG - Intergenic
1168768536 20:398616-398638 TTCTGACCAGTGAGATGTGTGGG - Intergenic
1169548418 20:6675001-6675023 CTGTGACCTGTGTGCTGTCCTGG - Intergenic
1172011430 20:31848305-31848327 GGCAGACCTGGGTGATGTGCCGG + Intronic
1175493711 20:59397386-59397408 CTCTGACCTGCCTGGTCTGCAGG + Intergenic
1180841391 22:18960466-18960488 CCCTGGCCTGTCTGATCTGCAGG + Intergenic
1181328124 22:22067093-22067115 ACCTTACCTGTGTGATGTTCAGG + Intergenic
1181422483 22:22811472-22811494 CTCTGACCTGTGGTCTGTCCTGG - Intronic
1182007007 22:26969322-26969344 ATCTGACTTCTGTGATGTGTTGG - Intergenic
1183720495 22:39559049-39559071 GTCTGGCGTGTGTGGTGTGCCGG + Intergenic
1185284625 22:49994739-49994761 GTCTCACCTGAGTGCTGTGCAGG - Exonic
1185367960 22:50445611-50445633 CTCTGACCTGTGGGTTTTCCAGG + Exonic
950146633 3:10654692-10654714 CTTGGAACTGTGTGGTGTGCAGG + Intronic
951520078 3:23603222-23603244 CTCTGATCTGTGTACTGTGTCGG + Intergenic
951981893 3:28575652-28575674 CTCCGACCTGTGCGAGGTGGTGG - Intergenic
953643073 3:44727794-44727816 CTCTGGCCTGTGAGATGTTAGGG + Intergenic
953911454 3:46895286-46895308 GTCTGGCCTGAGTGCTGTGCAGG - Intronic
956498558 3:69855751-69855773 CTCTGGCCTGTGTTATCTCCTGG - Intronic
956889517 3:73598444-73598466 CTCTTACCTGTGAGCTGTCCTGG - Intronic
960092599 3:113656699-113656721 CTCTGGCCTGTGTGGAGTACAGG + Exonic
960224719 3:115156394-115156416 TTGTGACCTGTATCATGTGCCGG + Intergenic
960944933 3:122959376-122959398 CTGTGTCCTGTGTGGTGTGCTGG - Intronic
961774391 3:129273817-129273839 ATTTGACCTGTTTGCTGTGCTGG + Intronic
962602110 3:137000272-137000294 CTTTGAACTGTGTGAGGTACAGG - Intronic
963368620 3:144369181-144369203 CTCTGACCTGTGTAAGCTGCCGG + Intergenic
964167473 3:153725795-153725817 AAATGACCTGTGTGATGGGCAGG - Intergenic
966680929 3:182641626-182641648 CTGAGACCTGAGGGATGTGCAGG + Intergenic
970499528 4:16663236-16663258 CCCTGACTTTTGTGGTGTGCTGG + Intronic
976085386 4:81402541-81402563 CGCTGTCCTGTGTCATCTGCTGG - Intergenic
981509578 4:145541122-145541144 CACTAACCTGTATGATGGGCAGG + Intronic
982733217 4:158978881-158978903 CTCTGTACTGAGTGCTGTGCTGG + Intronic
982846071 4:160253998-160254020 GGCAGAGCTGTGTGATGTGCTGG + Intergenic
985722923 5:1500065-1500087 CGCTGGCCTGCGTGATGTTCAGG - Intronic
986020771 5:3799828-3799850 CTCAGAGCTGTGTGCAGTGCAGG - Intergenic
990495468 5:56343440-56343462 CTCTGATCTGTGTCATCTCCAGG + Intergenic
991421181 5:66443916-66443938 CTCTGACTTGTCAGATGTTCCGG + Intergenic
992969069 5:82036903-82036925 CTCTTGACCGTGTGATGTGCCGG - Intronic
993694909 5:91049983-91050005 CTCTGACATGAGTCATGTGCGGG + Intronic
995879587 5:116829540-116829562 CTCTGAAGTGTGGGATGTGAGGG + Intergenic
997597539 5:135117109-135117131 CCCAGAGCTGTGTGATGTGCTGG + Intronic
997725047 5:136113387-136113409 CTCTGTACTATGTGCTGTGCTGG + Intergenic
999150497 5:149423277-149423299 CCACGCCCTGTGTGATGTGCCGG + Intergenic
999380303 5:151116878-151116900 CTTTGACCTGGGTGATCTGCAGG + Intronic
1002292623 5:178210116-178210138 CTCTGACCTGTGGGGGGAGCAGG - Exonic
1002313314 5:178327832-178327854 CTCTGAGCTGTGTGGGGCGCAGG - Intronic
1003472672 6:6451824-6451846 CCCTCATCTGTGTGGTGTGCTGG - Intergenic
1006629069 6:35418463-35418485 CTGAGAGCTGTGTGAGGTGCTGG - Intronic
1017648551 6:156561312-156561334 CTGGGATCTGTGTGATGTGGAGG - Intergenic
1019179773 6:170178899-170178921 CCCTGTCCTGGGTCATGTGCTGG - Intergenic
1020269969 7:6589219-6589241 CTCTGACCTGTGTGATGTGCAGG + Exonic
1023058183 7:36306331-36306353 CCCTGGCCTTGGTGATGTGCTGG - Intergenic
1026744131 7:72998068-72998090 TCCAGACCTGGGTGATGTGCAGG - Intergenic
1027030238 7:74882745-74882767 TCCAGACCTGGGTGATGTGCAGG - Intergenic
1027099606 7:75367024-75367046 TCCAGACCTGGGTGATGTGCAGG + Intergenic
1028921842 7:96318195-96318217 TTCAGACCTGTGAGATGTTCTGG - Intronic
1029378853 7:100199536-100199558 TCCAGACCTGGGTGATGTGCAGG + Exonic
1031357314 7:120802443-120802465 CTCTGAACAGGGTAATGTGCTGG - Intronic
1035275789 7:157747169-157747191 CCCTGAGCTGTGGGGTGTGCGGG + Intronic
1035275804 7:157747251-157747273 CTCTGAGCTGTGGGGTGTCCGGG + Intronic
1035275812 7:157747292-157747314 CTCTGAGCTGTGGGGTGTCCGGG + Intronic
1035275855 7:157747497-157747519 CCCTGAGCTGTGGGGTGTGCGGG + Intronic
1035275870 7:157747579-157747601 CTCTGAGCTGTGGGGTGTCCGGG + Intronic
1035275878 7:157747620-157747642 CTCTGAGCTGTGGGGTGTGCGGG + Intronic
1035275947 7:157747989-157748011 CTCTGAGCTGTGGGGTGTCCGGG + Intronic
1035276047 7:157748522-157748544 CTCTGAGCTGTGGGGTGTCCGGG + Intronic
1035276249 7:157749629-157749651 CTCTGAGCTGTGGGGTGTCCGGG + Intronic
1035276309 7:157749916-157749938 CTCTGAGCTGTGGGGTGTCCGGG + Intronic
1035724107 8:1813904-1813926 CACTGACCTCTGAGCTGTGCTGG + Intergenic
1036769888 8:11571703-11571725 CACCGAGCTGTGTGATGTGCTGG + Intergenic
1037339131 8:17823771-17823793 CTCTGAACTGTGTATTGTGTAGG + Intergenic
1039098598 8:33914948-33914970 ATCTGAACTGTGTGATGTGGGGG - Intergenic
1039199512 8:35073742-35073764 TTCTGACCTGTGTTCTGTGTTGG - Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041976389 8:63803678-63803700 CTCTGACCTGTTTGATCTCACGG + Intergenic
1044115741 8:88331115-88331137 TTCTGACCTGTGTGCAGTGGAGG + Intergenic
1045923330 8:107558541-107558563 CTCTGAACTATATGATGTGTGGG - Intergenic
1047498987 8:125428185-125428207 ATTTGACCTGGGAGATGTGCAGG - Intergenic
1048208077 8:132431492-132431514 CTCTGAGCTCTGAGATGAGCTGG - Intronic
1048292194 8:133189748-133189770 CTCTGTGCTGTGTGATGGGCAGG + Intergenic
1055883419 9:81030834-81030856 CTCTGACCTCTCTGATCAGCTGG + Intergenic
1059471356 9:114506771-114506793 CTCTGTGCTGGGTCATGTGCTGG + Intergenic
1060247482 9:121958555-121958577 CCATGACCTCTGTGAGGTGCTGG - Intronic
1060360017 9:122946204-122946226 CTATGACCTGTTTGATTTTCAGG - Intronic
1060368909 9:123050175-123050197 GTCTGCTCTGTGTGATGTGTTGG + Intronic
1060969055 9:127727583-127727605 CCCTCAGCTGTGTGATGGGCTGG + Intronic
1061319170 9:129816983-129817005 CTAAGACCTGTGAGTTGTGCAGG - Intronic
1061572317 9:131485407-131485429 GTCAGACCTGGGTCATGTGCTGG + Intronic
1203560688 Un_KI270744v1:53939-53961 CTCTGTGCTTTCTGATGTGCTGG + Intergenic
1188911329 X:35851490-35851512 GTCTGTCCTGTGTGGTGTCCTGG + Intergenic
1189285822 X:39851780-39851802 CTCTGGGTTGAGTGATGTGCAGG + Intergenic
1189315894 X:40056369-40056391 CACTGATCTGTGTGAGGTCCTGG - Intronic
1190254407 X:48751856-48751878 CTTTGTCCTGGGAGATGTGCTGG + Intergenic
1190463722 X:50704902-50704924 CTCTGACCAGTGGGAGGTGGAGG + Intronic
1193004994 X:76606503-76606525 CTTTGAGCTCTGAGATGTGCTGG + Intergenic
1194758811 X:97769444-97769466 ATCTGACCTCAGTGGTGTGCTGG + Intergenic
1199473545 X:148221501-148221523 CCCTGCCCTCTGTGATATGCTGG + Intergenic
1201512151 Y:14776674-14776696 CTTTGATCTGTGTGGTGTGTTGG + Intronic