ID: 1020269991

View in Genome Browser
Species Human (GRCh38)
Location 7:6589356-6589378
Sequence ACTGGCCGGAAGGCAGGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020269991_1020270000 14 Left 1020269991 7:6589356-6589378 CCCAGGCCTGCCTTCCGGCCAGT 0: 1
1: 0
2: 2
3: 14
4: 201
Right 1020270000 7:6589393-6589415 CAGGCACCTTCCTGCATGTGTGG 0: 1
1: 0
2: 3
3: 33
4: 614
1020269991_1020270002 21 Left 1020269991 7:6589356-6589378 CCCAGGCCTGCCTTCCGGCCAGT 0: 1
1: 0
2: 2
3: 14
4: 201
Right 1020270002 7:6589400-6589422 CTTCCTGCATGTGTGGCCTCCGG 0: 1
1: 0
2: 11
3: 61
4: 506
1020269991_1020269999 -5 Left 1020269991 7:6589356-6589378 CCCAGGCCTGCCTTCCGGCCAGT 0: 1
1: 0
2: 2
3: 14
4: 201
Right 1020269999 7:6589374-6589396 CCAGTATGGGCTTGTACATCAGG 0: 1
1: 0
2: 0
3: 5
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020269991 Original CRISPR ACTGGCCGGAAGGCAGGCCT GGG (reversed) Exonic
900966497 1:5962491-5962513 AAAGGCAGGCAGGCAGGCCTCGG - Intronic
901493160 1:9606908-9606930 ACTGGGGGGCAGCCAGGCCTTGG - Intronic
901635510 1:10668451-10668473 ACTGCCCAGGAGGCAGGCTTGGG + Intronic
902456430 1:16536700-16536722 ACTGGCCGGGAGTTAGGTCTCGG + Intergenic
902495733 1:16871211-16871233 ACTGGCCGGGAGTCAGGTCTCGG - Intronic
905923442 1:41733830-41733852 ACTGGGCTGGAGGCTGGCCTGGG - Intronic
906155990 1:43614263-43614285 ACAGGGCAGCAGGCAGGCCTGGG - Intronic
906237419 1:44220322-44220344 ACAGGCTGGGAGGCACGCCTGGG + Intronic
907190161 1:52641524-52641546 TCTGGCCCCAAGTCAGGCCTTGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
912132493 1:106619790-106619812 ACTGGCCTGTAGGCAACCCTTGG + Intergenic
915318869 1:155045030-155045052 GCTGGCGGGAGGGCAGGCCCTGG + Intronic
919846898 1:201648255-201648277 ACTGACAGGCAGGCAGGCCGCGG + Exonic
920827227 1:209433542-209433564 ACTGGCTGGGGGGCAGGGCTTGG - Intergenic
1062771487 10:104885-104907 ACTGGCCTGCAGGCACCCCTTGG - Intergenic
1065385382 10:25128526-25128548 ACTTGCGGGAGGGTAGGCCTGGG - Intergenic
1067317401 10:45181088-45181110 GCTGGCTGGAAGGCTGGCCAAGG + Intergenic
1068283720 10:54909328-54909350 ACTGGCCTGCAGGCACCCCTTGG - Intronic
1068348420 10:55813654-55813676 ACTGGCCTGCAGGCATCCCTTGG + Intergenic
1069592920 10:69652940-69652962 ACTGGCCTGCAGGCACCCCTTGG + Intergenic
1071667959 10:87578566-87578588 ACATGGCTGAAGGCAGGCCTAGG - Intergenic
1074774713 10:116758871-116758893 TCTGGGGTGAAGGCAGGCCTCGG + Intergenic
1075007757 10:118842727-118842749 ACTGGCCTGCAGGCACCCCTTGG + Intergenic
1076655191 10:132019259-132019281 GCTGGCCTGCAGGCAGCCCTTGG - Intergenic
1076721028 10:132393318-132393340 TCTGGCAGGGAGGCCGGCCTGGG - Intergenic
1076885018 10:133258221-133258243 ACCCGCCGGAAGACAGGCCCAGG - Intergenic
1077035994 11:494785-494807 ACAGGCCAGAAGGGAGGCATGGG + Intronic
1077540583 11:3144786-3144808 CCTGGCGGGAGGTCAGGCCTGGG + Intronic
1081748362 11:45488822-45488844 AGTGGCAGGAAGGCAAACCTGGG - Intergenic
1082983159 11:59142856-59142878 AGTCGCCGGTAGGCTGGCCTGGG - Exonic
1083295082 11:61711002-61711024 TGGGGCCAGAAGGCAGGCCTCGG + Intronic
1083900535 11:65641228-65641250 ACTGGTGGGAAGGCAGGCTCTGG - Exonic
1085412985 11:76302542-76302564 TCTCCCCGGAGGGCAGGCCTGGG + Intergenic
1085413477 11:76305630-76305652 ACTGGCTGGAGGAAAGGCCTCGG + Intergenic
1085514916 11:77106314-77106336 AGTGGCTGGAAGGCAAGCTTGGG - Intronic
1089257282 11:117200540-117200562 ACTGGCTCGAAGGCAGGACTCGG + Intronic
1091229985 11:133981984-133982006 ACTGGCCAGAAGGCAGGCTGTGG + Intergenic
1091434836 12:464206-464228 ACTGGCTGAAAAGCAGCCCTGGG + Intronic
1091549821 12:1529325-1529347 AGGGGCTGGAGGGCAGGCCTGGG + Intergenic
1091643720 12:2257215-2257237 ACTGGCCAGAAGTCAGCCATGGG + Intronic
1091662934 12:2398016-2398038 ACTGGCCCGAGGGCAGGCCCAGG + Intronic
1092524298 12:9300265-9300287 ACAGACCGGAGGGAAGGCCTGGG - Intergenic
1092542965 12:9431547-9431569 ACAGACCGGAGGGAAGGCCTGGG + Intergenic
1095357395 12:41291934-41291956 ACTGGGAGGAAGGCAGGACCAGG + Intronic
1096493733 12:52027167-52027189 ACGGGCTGGAAGTCAGGGCTGGG - Intronic
1101115135 12:101524318-101524340 ACGAGCTGGAGGGCAGGCCTTGG + Intergenic
1101898777 12:108775650-108775672 ACTGCCCTGAAGCCAGCCCTGGG + Intergenic
1102459119 12:113089395-113089417 TCTGACCAGAAGGCAGGCATGGG - Intronic
1103572495 12:121854496-121854518 ACTGGGAGGAAGGGAAGCCTGGG + Intronic
1106709538 13:32315409-32315431 ACCACCCGGAAGTCAGGCCTGGG - Intergenic
1112477989 13:99749481-99749503 AATAGCCAGAAGGCTGGCCTAGG + Intronic
1114349620 14:21835802-21835824 ACTGGCCTGAAGGCACTCCTTGG - Intergenic
1116504812 14:45665260-45665282 ACTGCCCTGAAGGGAGTCCTGGG - Intergenic
1119421418 14:74509915-74509937 ACTGGCAGGTAGGCAGGGGTGGG + Intronic
1121127807 14:91418669-91418691 ACTGGCTGGAAGGCAAGCCCGGG + Intergenic
1121180078 14:91922376-91922398 CCAGGGAGGAAGGCAGGCCTAGG - Intronic
1122171298 14:99877706-99877728 TCTGGCCTAAAGGCAGGCGTGGG - Intronic
1123940657 15:25215051-25215073 ACTGGCCCCAGGGCAGCCCTGGG + Intergenic
1124510022 15:30315971-30315993 ATGGGACGGCAGGCAGGCCTTGG + Intergenic
1124732868 15:32214582-32214604 ATGGGACGGCAGGCAGGCCTTGG - Intergenic
1127038953 15:54952092-54952114 ACTGTGTGGAAGGAAGGCCTTGG - Intergenic
1127565530 15:60184572-60184594 ACTGGCAGGCTGGCAGGGCTAGG - Intergenic
1128793115 15:70447737-70447759 CCTGTCCAGAAGGCATGCCTCGG - Intergenic
1129606207 15:77026262-77026284 ACTGGCCTGGAGGCTGGGCTTGG + Intronic
1130097181 15:80864459-80864481 ACTGCCCGGGAGGCAACCCTGGG + Intronic
1130113528 15:80986720-80986742 ACTGGCCTGGAGGCAGGGCTAGG - Intronic
1131636247 15:94235861-94235883 ATTGGCCAAGAGGCAGGCCTGGG + Intronic
1132549096 16:547061-547083 ACTGGCAGGAAGGCAGCCCCAGG - Exonic
1132816025 16:1826968-1826990 ACGGGCCGGGAGACGGGCCTGGG + Exonic
1132880817 16:2160982-2161004 ACTGGGCTGAGGGGAGGCCTCGG + Intronic
1137435113 16:48448396-48448418 ACTGCCCGGTAAGCAGCCCTGGG + Intronic
1137815155 16:51391866-51391888 ACCTGCCGGATGGCAGGACTGGG - Intergenic
1140209685 16:72960328-72960350 ACAGGGCGGAGGGCGGGCCTGGG + Intronic
1141525607 16:84609371-84609393 ACTGGCCTTAGTGCAGGCCTAGG - Intronic
1142802021 17:2352258-2352280 ACTGGCCCCCAGGCAGGCATTGG + Intronic
1143317776 17:6045752-6045774 GGAGGCCAGAAGGCAGGCCTTGG + Intronic
1146397890 17:32483486-32483508 GCTGGCCGGTGGGCTGGCCTGGG + Intergenic
1146642325 17:34550643-34550665 ACTGGACCAAAGGCAGACCTAGG - Intergenic
1148621198 17:49035876-49035898 ACTGGCTGGAAGGCAACCCCGGG + Intronic
1150137381 17:62703456-62703478 TCTGGCGGGAAGCCAGGCCAAGG + Intronic
1151299852 17:73216178-73216200 ACAAGCAGGAAGGCAGGCCCAGG + Intronic
1151408179 17:73902774-73902796 AGAGGCCGGCAGGCCGGCCTGGG - Intergenic
1152279504 17:79376944-79376966 ACTGGCGGGAGGGCAGGTGTCGG - Intronic
1152353289 17:79795036-79795058 GCTGGCCCGAAGACAGGACTCGG - Exonic
1152622831 17:81373778-81373800 CCAGGCCGACAGGCAGGCCTCGG - Intergenic
1152836838 17:82538752-82538774 TCTGGCCCCAGGGCAGGCCTGGG + Intronic
1155784499 18:29880076-29880098 AATGGCCTGAAGGCAGGAATAGG + Intergenic
1157693391 18:49701493-49701515 ACGGGCCTGAACCCAGGCCTGGG + Intergenic
1158139510 18:54241890-54241912 ACTGGCCTGCAGGCGGCCCTTGG - Intergenic
1158599753 18:58847171-58847193 ACTGGCAGGACGGCAGGGTTGGG + Intergenic
1159080104 18:63726940-63726962 ACTAGGTGGAAGGCAGGACTTGG - Intergenic
1160551728 18:79697703-79697725 ACAGGCCGAGAGGCAGGGCTGGG - Intronic
1160763485 19:797285-797307 ACTGGCCAGAAGGCCGCCCGGGG - Exonic
1160820630 19:1056096-1056118 CTTGGCCCGAGGGCAGGCCTGGG - Exonic
1161791854 19:6364701-6364723 ACTGGGCGGAAGTCAAGCGTGGG + Intronic
1163644949 19:18483885-18483907 ACTGTCCTGGAAGCAGGCCTGGG - Intronic
1166268746 19:41700841-41700863 ATTGACAGGAAGGCAGGACTTGG + Intronic
1166297292 19:41895366-41895388 ACAGACCGGAAGGGAGGCGTGGG + Exonic
1167889388 19:52527629-52527651 GCAGGACGGAAGCCAGGCCTGGG - Intergenic
927151162 2:20196943-20196965 ACTGCCTGGAGGGCAGCCCTTGG - Intergenic
929014531 2:37481516-37481538 ACTGGCCTGTAGGCAACCCTTGG + Intergenic
932322176 2:70830368-70830390 GCTGGGTGGAAGGCAGGGCTCGG + Exonic
932402647 2:71492226-71492248 ACTGGCCGGAAGGCTGCCAGAGG + Intronic
932592205 2:73074339-73074361 GCAGGCGGGCAGGCAGGCCTGGG - Exonic
932592501 2:73075759-73075781 GCAGGCAGGCAGGCAGGCCTAGG - Intronic
932667532 2:73708943-73708965 ACTGGCTGAGAGGAAGGCCTGGG - Intergenic
934933936 2:98451190-98451212 GCTGGCTGGCTGGCAGGCCTGGG - Intronic
936053386 2:109242295-109242317 ATTGGGTGGAAGCCAGGCCTGGG + Intronic
936165568 2:110116584-110116606 ACTGGCTGGAAGGAAGGCCAGGG - Intergenic
939969831 2:148645761-148645783 ACTGGCCGGCGGGCGGCCCTCGG - Intronic
940499287 2:154474522-154474544 ACAGGGTGGAATGCAGGCCTAGG - Intergenic
942485949 2:176439853-176439875 GCTGGTGGGAAGGCAGGCTTTGG - Intergenic
945887775 2:215394802-215394824 ACAGGGCGGAATGCAGGACTTGG + Intronic
946043275 2:216800657-216800679 AATGGCTGGAAGGCAGGCTGGGG - Intergenic
946851208 2:223908900-223908922 ACTGTCCGGGAAGCAGGGCTGGG - Intronic
947783702 2:232794837-232794859 ACTGGCCGGAGAGTAGGACTAGG - Exonic
948904964 2:240975388-240975410 ACTGGCCTGAGGGCAGGACGGGG + Intronic
1168799595 20:635592-635614 GCAGGCAGGAGGGCAGGCCTGGG - Intergenic
1171511061 20:25685424-25685446 ACTGGAAGGAAGGCAGGGCCAGG + Intronic
1172380197 20:34483136-34483158 ACAAGCCTGTAGGCAGGCCTAGG - Intronic
1173964403 20:47100989-47101011 ACTGGCTGGAATGCAGACATGGG - Intronic
1174188232 20:48722050-48722072 ACGGGCCGGAAGACAAGCCCAGG + Intronic
1175443701 20:59006957-59006979 ACCGGCGGGGAGGCAGCCCTGGG - Intronic
1175773724 20:61640219-61640241 CCAGGCCGCAAGGCTGGCCTGGG - Intronic
1176159856 20:63642463-63642485 ACAGGCCGGATGGCAGGCGAGGG - Intronic
1176968948 21:15243762-15243784 AGTGGCCAGAATGCAGGACTCGG + Intergenic
1178641042 21:34344970-34344992 AGGGGCAGGAAGGCAGGCTTAGG + Intergenic
1179179627 21:39034537-39034559 GCTGGCTGGAAGGCAGGTTTGGG - Intergenic
1179561262 21:42217585-42217607 ACTGCCCGGGTGCCAGGCCTTGG - Intronic
1179746273 21:43445665-43445687 ACTGCCCGGAGAGCAGGGCTGGG + Intergenic
1180707547 22:17818579-17818601 ACTGGCCTGAAGGCAGGCGTGGG + Exonic
1183598262 22:38825164-38825186 CCTGGCTGGAAGGCAGGACAAGG - Intronic
1183981600 22:41543913-41543935 ACTGGCCGCAGGCCCGGCCTCGG - Intronic
1184681754 22:46075975-46075997 ACAGGACGGAAAGCATGCCTGGG + Intronic
1184688426 22:46106725-46106747 CCTGGAAGGAAGGCAGCCCTGGG + Intronic
1185173014 22:49304434-49304456 TGTGGCCGGGAGGCAGGGCTGGG - Intergenic
949935161 3:9110621-9110643 GCTGATCGGACGGCAGGCCTGGG - Intronic
950039361 3:9910023-9910045 CCTGGCCAGAATGGAGGCCTGGG + Intronic
951817289 3:26768312-26768334 ACTGGCCAGATGGCAGGCCTGGG + Intergenic
954985166 3:54784191-54784213 GGTGTCCGGAAGGCAGGCCAGGG + Intronic
961260382 3:125596839-125596861 CCAGGCCGGAAACCAGGCCTGGG + Intergenic
961504126 3:127358945-127358967 ACTGGCTAGAAGGCAGGGGTGGG + Intergenic
962769339 3:138597766-138597788 CCTGGCCCGAAACCAGGCCTGGG - Intergenic
965599149 3:170438250-170438272 ACTGGCCGGAAGGTGGAGCTGGG - Intronic
968538711 4:1151300-1151322 ACTGGCCTGCAGGCACCCCTTGG - Intergenic
968583306 4:1404754-1404776 CCTGGCCGGAGAGCAGGCCGCGG - Intronic
968726537 4:2250505-2250527 GCTGGCGGGCAGGCAGGCCAAGG + Exonic
969300031 4:6292242-6292264 ACTGGAGGGAAGGCAGACCCAGG + Intronic
969475701 4:7421497-7421519 GCTGGCTAGAAGCCAGGCCTGGG - Intronic
969859004 4:10021223-10021245 GCTGTGGGGAAGGCAGGCCTGGG - Intronic
973730092 4:53814900-53814922 GCTGGCTGGGAGGCAGGCATGGG + Intronic
977597916 4:98903969-98903991 ACTGGCAGGCAGGTAGGCTTTGG + Intronic
984325157 4:178241902-178241924 ACTGGCCCGAAGGCACCCCTTGG + Intergenic
984330889 4:178316409-178316431 ACTGGCAGGAAGCCAAGGCTAGG - Intergenic
985555531 5:556141-556163 ACTGGGCTCCAGGCAGGCCTGGG + Intergenic
986333004 5:6731667-6731689 ACTAGCTGGACTGCAGGCCTGGG + Intronic
993915727 5:93741405-93741427 TCTGGCCGGCAGTCAGGCCAGGG - Exonic
994245438 5:97471311-97471333 ACTGGCCTGCAGGCATCCCTTGG - Intergenic
995998814 5:118333167-118333189 ATGGGCCAGAAGGCAGTCCTCGG - Intergenic
997329962 5:133052639-133052661 ACTGGAAGGACTGCAGGCCTAGG + Intronic
997645348 5:135477953-135477975 AGTGGACAGAGGGCAGGCCTGGG - Intergenic
998115109 5:139531194-139531216 CCAGGCCTGAAAGCAGGCCTGGG + Intronic
999020380 5:148159058-148159080 ACAGGCAGGAAGGCTGGCGTAGG - Intergenic
1000106473 5:158064535-158064557 ACTGGCCAGAAAACAGACCTTGG - Intergenic
1000192025 5:158920482-158920504 ACTGGACACATGGCAGGCCTTGG + Intronic
1001242868 5:170083442-170083464 CCTGGAAGGAAGGCAGGCCCAGG + Intergenic
1002461892 5:179378016-179378038 ACTGGCTGGAAAGGAGGCTTTGG - Intergenic
1005277106 6:24231067-24231089 CCTGGATGGAAGGCAGGCCATGG - Intronic
1005870676 6:29972333-29972355 ACAGGCAGAAAGGCAGGGCTGGG - Intergenic
1006596255 6:35194567-35194589 AGTGGCAGGAAAGCAGGCTTTGG - Intergenic
1007065663 6:38987987-38988009 GCTGGTCAGAAGGCAAGCCTGGG - Intronic
1007072565 6:39048255-39048277 TCTGTCCTGAAGGCAGGCCCAGG - Intergenic
1007450128 6:41936090-41936112 ACAGGCCCGCAGGCAGTCCTGGG + Exonic
1008705068 6:54147825-54147847 ACTTGCTGGCATGCAGGCCTTGG + Intronic
1011032898 6:82942554-82942576 AGTGGCTGGGATGCAGGCCTGGG - Intronic
1011613236 6:89173823-89173845 CTTGGCTGGCAGGCAGGCCTTGG - Intergenic
1012588096 6:100947430-100947452 ACTGGCCAGAAGCTTGGCCTTGG + Intergenic
1013170618 6:107634300-107634322 ACTGGCGGGAAGGGAAGACTCGG - Exonic
1017342793 6:153345578-153345600 ACTGGCCGGAGGGCGGGGGTGGG - Intergenic
1019034218 6:169041230-169041252 AGGGGCAGGAAAGCAGGCCTGGG + Intergenic
1019152514 6:170018489-170018511 GCTGGTGGGAAGGCAGGCCAGGG + Intergenic
1019514076 7:1432140-1432162 ACAGGCAGGAACGCAGCCCTGGG - Intronic
1020269991 7:6589356-6589378 ACTGGCCGGAAGGCAGGCCTGGG - Exonic
1020812489 7:12864227-12864249 ACTGGCCTGCAGGCATGCCTTGG - Intergenic
1021865929 7:24957250-24957272 ATTGACCGGAAGGCAGGCATTGG - Intronic
1022525890 7:31037057-31037079 AGTGGCCAGGAGGCAGCCCTGGG + Intergenic
1023987462 7:45105083-45105105 TCTAGCCAGAAGCCAGGCCTGGG + Intronic
1024306333 7:47932490-47932512 CCTGGCAGGGAGGCAGGGCTTGG + Intronic
1026398370 7:69983006-69983028 AGTGGCCAGAAGGGAGACCTTGG + Intronic
1033220699 7:139524678-139524700 ACTGCCCCGGAGGCAGGCCAGGG - Intronic
1033598069 7:142870586-142870608 AATGGCTGAAAGCCAGGCCTGGG - Exonic
1034895126 7:154871640-154871662 ACTGGCGGAGAGGCAGGCCTTGG - Intronic
1035551711 8:533060-533082 AGTGGTCTGGAGGCAGGCCTGGG - Intronic
1035920988 8:3675958-3675980 ACTGGGAAGATGGCAGGCCTGGG - Intronic
1037916582 8:22776905-22776927 ACTGGCCTGAAGGATGGCATTGG + Intronic
1040578957 8:48679638-48679660 AGTGGCCAGGAGGCAGCCCTTGG + Intergenic
1040610415 8:48977448-48977470 ACTGGGAGGAACCCAGGCCTAGG - Intergenic
1045799624 8:106087381-106087403 CCAGGCCCGAAAGCAGGCCTGGG - Intergenic
1048821177 8:138382178-138382200 GCTGGGAGGAGGGCAGGCCTTGG - Intronic
1049710002 8:144059175-144059197 ACAGGCCGGTCGGCAGGCCCAGG + Intronic
1049761087 8:144332339-144332361 CGGGGCCGGCAGGCAGGCCTGGG - Exonic
1050119373 9:2292651-2292673 AGTGGCCAGAAGGCAGCCCAAGG - Intergenic
1053353964 9:37431115-37431137 AGTGGCCTGAAGGCACCCCTAGG - Intronic
1053667486 9:40326292-40326314 AGTGGCAGCAAGGCAGGCTTGGG - Intronic
1054378631 9:64466319-64466341 AGTGGCAGCAAGGCAGGCTTGGG - Intergenic
1054517125 9:66049993-66050015 AGTGGCAGCAAGGCAGGCTTGGG + Intergenic
1059483750 9:114611660-114611682 TCTGGCCCGAACGCAGGCCAAGG - Intronic
1062111698 9:134785465-134785487 CCTGGCAGGAAGGAAGGCCGGGG + Intronic
1062436381 9:136548243-136548265 ACAGGTCGGGAGGCAGCCCTGGG + Intergenic
1062537582 9:137027707-137027729 CCAGGACAGAAGGCAGGCCTGGG - Exonic
1062754163 9:138278637-138278659 ACTTGCTGGGAGGCAGGGCTGGG - Intergenic
1189717666 X:43882359-43882381 GCTGGCTGGCAGGCAGGACTGGG - Exonic
1190360592 X:49645073-49645095 ACTGGCCTGCAGGCACTCCTTGG - Intergenic
1190620724 X:52284701-52284723 ACTGGCCTGCAGGCAGCCCTTGG - Intergenic
1190730679 X:53223675-53223697 TCTAGCCTGAAGCCAGGCCTAGG + Intronic
1192221928 X:69203301-69203323 TCTGGCCTGGAGGAAGGCCTTGG + Intergenic
1198270980 X:135055823-135055845 ACTGGCAGGCCGGCAGGCCATGG + Intergenic
1199614741 X:149647689-149647711 ACTGGCCTGTAGGCATCCCTTGG + Intergenic