ID: 1020270290

View in Genome Browser
Species Human (GRCh38)
Location 7:6590577-6590599
Sequence AGGATCCCCGCGCTCGCGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020270279_1020270290 22 Left 1020270279 7:6590532-6590554 CCCCAGCGATGCAGGGCTGTGTC 0: 1
1: 0
2: 0
3: 29
4: 305
Right 1020270290 7:6590577-6590599 AGGATCCCCGCGCTCGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1020270281_1020270290 20 Left 1020270281 7:6590534-6590556 CCAGCGATGCAGGGCTGTGTCAA 0: 1
1: 0
2: 2
3: 259
4: 10203
Right 1020270290 7:6590577-6590599 AGGATCCCCGCGCTCGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1020270278_1020270290 28 Left 1020270278 7:6590526-6590548 CCTTTTCCCCAGCGATGCAGGGC 0: 1
1: 0
2: 1
3: 16
4: 117
Right 1020270290 7:6590577-6590599 AGGATCCCCGCGCTCGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1020270285_1020270290 -4 Left 1020270285 7:6590558-6590580 CCGCGGGCGCCCCATGTCCAGGA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1020270290 7:6590577-6590599 AGGATCCCCGCGCTCGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1020270280_1020270290 21 Left 1020270280 7:6590533-6590555 CCCAGCGATGCAGGGCTGTGTCA 0: 1
1: 0
2: 0
3: 33
4: 532
Right 1020270290 7:6590577-6590599 AGGATCCCCGCGCTCGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020270290 Original CRISPR AGGATCCCCGCGCTCGCGCT CGG Intronic