ID: 1020271405

View in Genome Browser
Species Human (GRCh38)
Location 7:6598629-6598651
Sequence CTGTGCACACAGGCAGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020271399_1020271405 6 Left 1020271399 7:6598600-6598622 CCCAGAGAGAGGGGGCTGAGGAC No data
Right 1020271405 7:6598629-6598651 CTGTGCACACAGGCAGCCTAAGG 0: 1
1: 0
2: 1
3: 19
4: 217
1020271398_1020271405 7 Left 1020271398 7:6598599-6598621 CCCCAGAGAGAGGGGGCTGAGGA No data
Right 1020271405 7:6598629-6598651 CTGTGCACACAGGCAGCCTAAGG 0: 1
1: 0
2: 1
3: 19
4: 217
1020271400_1020271405 5 Left 1020271400 7:6598601-6598623 CCAGAGAGAGGGGGCTGAGGACG No data
Right 1020271405 7:6598629-6598651 CTGTGCACACAGGCAGCCTAAGG 0: 1
1: 0
2: 1
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020271405 Original CRISPR CTGTGCACACAGGCAGCCTA AGG Intronic