ID: 1020271405

View in Genome Browser
Species Human (GRCh38)
Location 7:6598629-6598651
Sequence CTGTGCACACAGGCAGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020271400_1020271405 5 Left 1020271400 7:6598601-6598623 CCAGAGAGAGGGGGCTGAGGACG 0: 1
1: 0
2: 1
3: 23
4: 263
Right 1020271405 7:6598629-6598651 CTGTGCACACAGGCAGCCTAAGG 0: 1
1: 0
2: 1
3: 19
4: 217
1020271399_1020271405 6 Left 1020271399 7:6598600-6598622 CCCAGAGAGAGGGGGCTGAGGAC 0: 1
1: 0
2: 7
3: 28
4: 347
Right 1020271405 7:6598629-6598651 CTGTGCACACAGGCAGCCTAAGG 0: 1
1: 0
2: 1
3: 19
4: 217
1020271398_1020271405 7 Left 1020271398 7:6598599-6598621 CCCCAGAGAGAGGGGGCTGAGGA 0: 1
1: 1
2: 5
3: 50
4: 418
Right 1020271405 7:6598629-6598651 CTGTGCACACAGGCAGCCTAAGG 0: 1
1: 0
2: 1
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020271405 Original CRISPR CTGTGCACACAGGCAGCCTA AGG Intronic
900539485 1:3195766-3195788 CTGTTCTCACAGGGAGCCTTGGG - Intronic
900675311 1:3881496-3881518 TAGTGCACACAGGCAAGCTATGG - Intronic
901125780 1:6927814-6927836 CTGTGCACCAAGGCTGCCTGAGG - Intronic
901627700 1:10633131-10633153 GTGGGCACACAGGGAGCCGATGG - Intergenic
902555997 1:17247115-17247137 CTGTGCTCACAAGAAGGCTAGGG + Intergenic
903136989 1:21315869-21315891 CTGTCTACACAGGCAGCGTCAGG + Intronic
904048828 1:27625988-27626010 CTGTGCTCCCAGCCACCCTAGGG + Intronic
904882756 1:33713205-33713227 CTGTGCACTCATGCAGGCCAAGG - Intronic
905206771 1:36347076-36347098 CTTTGCACACGGGCAGCCCTGGG + Intronic
906737250 1:48142280-48142302 GTCTGCAGACAGGGAGCCTAAGG + Intergenic
906901504 1:49841893-49841915 CTGTGGAGACAGGCAGCCCAGGG - Intronic
907253058 1:53156050-53156072 CTGTGCACACGGACAGCCCAAGG + Intergenic
916006383 1:160664954-160664976 CTGAGCACAAAGGCTGCCCATGG - Intergenic
918052053 1:180982197-180982219 CTGTACATAAAGGAAGCCTATGG - Intronic
918164970 1:181936334-181936356 ATGCTCACACAGGCAGCCTGAGG - Intergenic
918247007 1:182669474-182669496 CAGTTCACACAGGAGGCCTATGG + Intronic
919805230 1:201377516-201377538 CTGCGGACACAGGCAGACTCTGG + Intronic
919956140 1:202418131-202418153 CTCTGAAAATAGGCAGCCTAGGG - Intronic
920870194 1:209787691-209787713 CTGTTGACACAGAAAGCCTAGGG - Exonic
922798220 1:228351960-228351982 CTGTGGAGACATCCAGCCTACGG + Intronic
1063437613 10:6047201-6047223 ATGTGGACACAGGTAGCCCAAGG + Intronic
1066164444 10:32771775-32771797 CTGGTCCCACAGGCAGACTAAGG + Intronic
1067625030 10:47918663-47918685 CTCTGCACGCAGGCAGCATCGGG + Intergenic
1067776897 10:49170644-49170666 CTGTGCACTCAAACAGCCAAGGG + Intronic
1068444886 10:57108269-57108291 CTGTGCAGAGGGGCAGCCTCTGG + Intergenic
1069453210 10:68533924-68533946 GTGAGGACATAGGCAGCCTAAGG + Intergenic
1070787129 10:79168369-79168391 ATCTGCACACAGGCACCCCATGG + Intronic
1073042442 10:100616850-100616872 CTGTGCTCACAGTTAGGCTATGG - Intergenic
1073080938 10:100860311-100860333 CAGTGCACTCTGGCAGACTAGGG + Intergenic
1073498145 10:103912613-103912635 CTCTGCACACAGGCACTCCAAGG - Intronic
1073514231 10:104062661-104062683 CTGTGCACCAAGGCACCCCAGGG - Intronic
1075263030 10:120979398-120979420 CTGCGCACACAAGTCGCCTAGGG + Intergenic
1075691838 10:124401507-124401529 CTGTGAACTCAGGAAGCCCACGG + Intronic
1076576693 10:131474276-131474298 CCCTGCACACACGCAGCCTGTGG + Intergenic
1076724609 10:132407593-132407615 CTGGGCAGCCAGGCAGCCTGGGG - Intronic
1077046825 11:550365-550387 CTGTGCCCACCCGCACCCTATGG + Intronic
1077366299 11:2162652-2162674 CTCTGCACACACCCAGCCTTTGG + Intergenic
1077405593 11:2381127-2381149 CTGTGCAGCCAGACAGCCTGGGG - Intronic
1078528941 11:12121542-12121564 ATGTGCACACAGGAAACCCAGGG - Intronic
1079400584 11:20103471-20103493 CTGTGCACACAGGTGGCCCGGGG + Intronic
1080074658 11:28134802-28134824 CTGAGCACATTGGCAGCCTTGGG - Intronic
1081529356 11:43947422-43947444 CTGTGCTCACAGGCATTCCAAGG + Intergenic
1081659098 11:44877067-44877089 GTGTGCACAAATGCAGCCTGTGG + Intronic
1083572304 11:63767241-63767263 CTGGGCACACAGGCAGGTTCTGG + Intronic
1086040052 11:82465329-82465351 CAGAGCAAACAGGCAACCTACGG - Intergenic
1087305092 11:96479844-96479866 CTGCTCACCCAGGCAGCCAATGG + Intronic
1088238503 11:107750241-107750263 CTGAGTACACAAGCCGCCTATGG - Intergenic
1088399644 11:109409042-109409064 CTTTTCAGACAGGCAGACTAAGG + Intergenic
1089331366 11:117691214-117691236 CTCTGCACACGGGGATCCTAGGG + Intronic
1090644888 11:128759333-128759355 CTGTGCTCAAAGTCAGCCTCTGG - Intronic
1091054957 11:132409197-132409219 CTGAGAACATAGGCAGCCTGGGG - Intergenic
1091583528 12:1802837-1802859 CTCTGCACACCGGCAGCCTGTGG + Intronic
1093213009 12:16329717-16329739 CTGTGCACACACTCTACCTAAGG + Intergenic
1095886015 12:47189253-47189275 CTTTGCACAAAGGCATCCAATGG - Intronic
1096493797 12:52027477-52027499 CTGTGCCCACTGGCAGCCTCTGG + Intronic
1098171419 12:67750984-67751006 CTGTCCACAAAGGCAGCATTTGG + Intergenic
1101923031 12:108948159-108948181 CTGAGCACACAGGGAGCTAAGGG - Intronic
1106502310 13:30340610-30340632 CTGGGGACACAGGGAGCCTATGG + Intergenic
1112018955 13:95354941-95354963 CTCTGCAGACAGGCAGGCTGAGG - Intergenic
1113506471 13:110820559-110820581 CTGTGGACACAGGGAACTTAAGG + Intergenic
1114565342 14:23627757-23627779 CTGTGCATGCAGACAGCCCAAGG + Intergenic
1115098331 14:29667120-29667142 ATGTGCACACAGTAAGCCTGAGG + Intronic
1121095295 14:91214218-91214240 CTGTGCACACGGCCAGCCACGGG - Intronic
1121278916 14:92686300-92686322 CTGCCCACACAGGCTGACTATGG + Intronic
1121455907 14:94038744-94038766 CCCTGCCCCCAGGCAGCCTACGG - Intronic
1121903080 14:97712196-97712218 CTCTGCAGACAGGCAGAATAGGG + Intergenic
1122089794 14:99330685-99330707 CTGTGCAGATAGGCAGCCTAAGG - Intergenic
1122125606 14:99576943-99576965 CCGTGCCCCCAGGCAGCCTGGGG - Intronic
1122388996 14:101367702-101367724 GTTTGCACACACACAGCCTAGGG + Intergenic
1122855889 14:104559908-104559930 CGGGGCGCCCAGGCAGCCTAGGG - Intronic
1123039374 14:105484114-105484136 CTGGGCATAGAGGCAGCCTGGGG + Intergenic
1123699435 15:22903530-22903552 CTGTGTGCACAGGCAGCCTCGGG - Intronic
1126357330 15:47810590-47810612 ATGTGGACTGAGGCAGCCTATGG - Intergenic
1129513597 15:76142823-76142845 CTCTGCACTCAGGCTGCCGATGG + Intronic
1130064184 15:80591241-80591263 CTGTGCACAAAGGCCTCCTGCGG - Intronic
1132327440 15:100983537-100983559 CTGAGCATCCCGGCAGCCTATGG + Exonic
1132952109 16:2568937-2568959 CTGTGCCCACAGCCAGCCTCAGG + Intronic
1132962241 16:2631233-2631255 CTGTGCCCACAGCCAGCCTCAGG - Intergenic
1134103059 16:11466154-11466176 CTATGCACACAGTCAGCACATGG - Intronic
1136316588 16:29458057-29458079 GTGTGGTCACAGGCAGCCCAGGG - Intronic
1136431164 16:30197399-30197421 GTGTGGTCACAGGCAGCCCAGGG - Intronic
1136646572 16:31624342-31624364 CTGTCCACACAGGGACCCTCAGG + Intergenic
1138154434 16:54689649-54689671 ATATGCAAACAGACAGCCTAGGG + Intergenic
1141512252 16:84519959-84519981 GTGTGCACTCAGGCAGCCCCCGG + Intronic
1142198728 16:88751017-88751039 CTGGGCACAGAGCCAGACTATGG - Intronic
1142222567 16:88862842-88862864 GTGTGCACATAAGCAGCCTTGGG + Intergenic
1142410863 16:89915914-89915936 CTGTTCACACACGCAGCCCCAGG - Intronic
1144750767 17:17646873-17646895 CTGCGCCAACAGGCAGCCCACGG + Intergenic
1145961034 17:28886663-28886685 CCCTGCACACAGACTGCCTAGGG - Intronic
1147551425 17:41445204-41445226 CTGCGAACTCAGGCAGCCTCTGG + Intergenic
1151434799 17:74088415-74088437 CTCTGCACACAGCCTGCCTCTGG + Intergenic
1153519337 18:5937404-5937426 CTGTGCACACAGGGGATCTAGGG + Intergenic
1155255334 18:23992343-23992365 CTTTGCTCACATGAAGCCTATGG + Intergenic
1157279676 18:46337945-46337967 CTGAGTACACAGGCGGCCAAAGG - Intronic
1159760166 18:72415993-72416015 CAGAGCAAACAGGCAACCTACGG + Intergenic
1162345118 19:10114268-10114290 CTGCTCACGCTGGCAGCCTACGG + Exonic
1162730471 19:12715528-12715550 CTCTGCACTCAGGGAGCCTTTGG - Exonic
1163696796 19:18768358-18768380 CTGTGATCACAGGCAGCCCCTGG - Intronic
1164089117 19:21932164-21932186 GTATGCACACAGGCAGAGTAAGG + Intergenic
1164193381 19:22931965-22931987 ATATGCACACAGGCAGAGTAAGG + Intergenic
1164675147 19:30095749-30095771 CTGTGCTCAGAAGCAGCTTAGGG + Intergenic
1164831688 19:31326901-31326923 CTGTGCACACTGGCACACTGGGG - Intronic
1165490482 19:36120479-36120501 CTGGGGACAGAGGCAGCCTCTGG + Intronic
1166852069 19:45765861-45765883 CTGTGCAGAAAGGGTGCCTAGGG + Exonic
925153791 2:1635125-1635147 CAGTGCACACAAGCAGCCCCAGG + Intronic
926794415 2:16607222-16607244 CTGTGCAGACGGTCAACCTAAGG + Intronic
927849811 2:26491762-26491784 CCCTGCACACAGGCAGGCTCAGG + Intronic
927942458 2:27113604-27113626 ATTTGAACACAGGCAGCCTGAGG - Intronic
930653127 2:53982180-53982202 CTTTGCTCACAGGCAGACAATGG + Intronic
932103799 2:68924742-68924764 CTGTGCACACAGAGAGACTTGGG + Intergenic
932272003 2:70419109-70419131 CTCTTCACACAGGCCCCCTAAGG - Intergenic
932592524 2:73075837-73075859 CTTTGGAGACAGGCAGCCTGGGG - Intronic
935354796 2:102187950-102187972 CTGTGGACTCGGGCAGCCTCTGG - Intronic
935750853 2:106232659-106232681 CTGTGCACAGAGGGAGCATGTGG + Intergenic
936271862 2:111055169-111055191 CTGAGCACAAAGGCAGACAAAGG - Intronic
937122366 2:119449706-119449728 TTGTTCACACAAGCAGCCTGGGG + Intronic
937250044 2:120517911-120517933 CTGTGCACACAGGTGGTCTAAGG + Intergenic
938387337 2:130876207-130876229 CTGGGGGCACAGGCGGCCTAGGG + Intronic
941079369 2:161042374-161042396 CTTTGCACACTGGCATCCCATGG - Intergenic
941484240 2:166059693-166059715 CTGTGCAGATATGCATCCTAAGG - Intronic
941920837 2:170849274-170849296 CTGTCCCCACAGGCTGCCTGGGG + Exonic
942188869 2:173451260-173451282 CTGTGAACACAGGACGCCTGTGG - Intergenic
944205378 2:197152706-197152728 CTGTGTAGACAGGCAGACTGAGG + Intronic
946403141 2:219479293-219479315 CTGTGCCCACAGGAAGCCAGGGG + Intronic
948123796 2:235550202-235550224 CCGAGCACACAGGCAGCCCGAGG + Intronic
948282465 2:236757972-236757994 CTGTGCACACTGGCATGCTAAGG + Intergenic
948809610 2:240467876-240467898 CGCTGCACACAGACGGCCTAGGG + Exonic
949064763 2:241983398-241983420 CCTGGCACACAGGCAGCCTGCGG - Intergenic
1168880026 20:1198552-1198574 CTGTGCACTGAGGCACCCTGAGG - Intergenic
1170213113 20:13865066-13865088 TTGTGCACATAGGCAGCAAAGGG - Intronic
1170853659 20:20027707-20027729 CTGTGCACTCAGGTGCCCTAAGG - Intronic
1173276947 20:41593394-41593416 CTGTGCATACAGAAAGCCTTTGG - Intronic
1173833759 20:46111526-46111548 CTCAGCACTCAGGCAGCCTATGG - Intergenic
1174742174 20:53025768-53025790 CAGTGCACACAGGCCCCCAAAGG + Intronic
1175041808 20:56059198-56059220 GAGTGCCCACAGGCAGCCTATGG + Intergenic
1175457190 20:59124311-59124333 CTGTGCTTCCAGCCAGCCTATGG - Intergenic
1175892513 20:62321797-62321819 CAGGGCACACAGGAAGGCTAGGG + Intronic
1175918626 20:62439512-62439534 CTGAGCCCACAGGCACCCTGAGG + Intergenic
1178476307 21:32940271-32940293 CTGGGCACACAGGCAGAGTCGGG - Intergenic
1179522848 21:41956351-41956373 GTGTGCACACAGGCCGCCTGCGG + Intergenic
1179603816 21:42499225-42499247 CTGTGCACCCAGGAAGCCCCAGG + Intronic
1180004381 21:45013315-45013337 CTGTGCAAACAGCCAGCAGAAGG + Intergenic
1180071737 21:45440205-45440227 CTGTGCACACAGGCTCCCGCTGG + Intronic
1181331185 22:22092748-22092770 CTATGCACACAGGCTGCAAAAGG + Intergenic
1181497451 22:23295529-23295551 CTGTGCTTGCAGGCAGCCTCTGG - Intronic
1182738062 22:32545244-32545266 CTCTGCACAAAAGCAGCCCAGGG - Intronic
1183499468 22:38169699-38169721 CTGTGCACAGTGGCAGCACAGGG - Intronic
1185197607 22:49482097-49482119 CTGTGCTTACAGGCAGCTTCTGG + Intronic
949096696 3:94967-94989 TTGAGAACCCAGGCAGCCTACGG + Intergenic
950659926 3:14460934-14460956 CTGGGCCCACAGGCAGCAGATGG + Intronic
950682683 3:14595821-14595843 ATGTGCACAGGGGCAGCCCAGGG + Intergenic
952227218 3:31390828-31390850 ATGTGCACACACGCAAACTATGG - Intergenic
952932631 3:38372011-38372033 CTGTGCAGACAAGCAGCTTGAGG + Intronic
954124142 3:48518847-48518869 CTGTGGACACTGGCAGCCAATGG - Exonic
955665183 3:61342771-61342793 ATGAACACACAGGCGGCCTATGG + Intergenic
961202698 3:125056714-125056736 CTGTGAATTCAGGCAGGCTAGGG + Intergenic
962410829 3:135140623-135140645 CAGTGCACACAGGAAGCCTGAGG - Intronic
964179292 3:153864792-153864814 CTGTGCACAGAGGGAGCATTTGG + Intergenic
966595136 3:181719304-181719326 CTGTACACGCAGGCAGACTAGGG - Intergenic
968278473 3:197458391-197458413 TCCTGCACACAGGCACCCTAAGG + Intergenic
968699714 4:2048758-2048780 CTGTGCACCCAGGAAACCTCTGG - Intergenic
968830349 4:2930421-2930443 CTCTGCACAGTGGCAGCCTGGGG - Intergenic
968958015 4:3728815-3728837 CTGTGCACACGGGCACCCCCAGG + Intergenic
969312001 4:6358543-6358565 CAGAGCAAACAGGCAACCTACGG + Intronic
969315194 4:6377701-6377723 CTGCGGACCCAGGCAGCCTGGGG - Intronic
973245907 4:48011049-48011071 CTGTGCTCTCAGGCAGCAGATGG + Intronic
974323740 4:60387273-60387295 CTGAGCACACTGGGAGGCTAAGG - Intergenic
976681322 4:87759271-87759293 CTGTGCACACAGGCAGAGAGAGG - Intergenic
976970599 4:91097069-91097091 CTGTGCACACAGGCACCGGCTGG - Intronic
984229179 4:177073620-177073642 CAGTGCACCCAGGCAGCTTGTGG + Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571148 5:646020-646042 CTGTCCACACAGGCCGCCGATGG - Intronic
985675258 5:1227921-1227943 GTGTGGACACAGCCAGCCCAGGG - Intronic
985717089 5:1468798-1468820 CTGTGTCCACAGTCAGCCTGGGG + Intronic
986165934 5:5271449-5271471 CTGCCCAGACAAGCAGCCTACGG + Intronic
986195745 5:5535316-5535338 CTGTGGACAGGGGCAGCCTCAGG + Intergenic
987504073 5:18747336-18747358 CTGTGGCCTCAGGCAGCATAGGG - Intergenic
990735066 5:58851357-58851379 CCGTGCACACAGGCAGCTCCAGG + Exonic
994807543 5:104470120-104470142 CTGTACACACTTGTAGCCTAGGG - Intergenic
997353955 5:133250417-133250439 CTGTGCACTCAGGGAGGCTGGGG + Intronic
1001587694 5:172844623-172844645 CTTTGGGCACAGGCAGCCTCGGG + Intronic
1002022641 5:176374205-176374227 CTGTGTACAGAGGCAGCTTTAGG + Exonic
1002890241 6:1325752-1325774 CTGTGCAAACAGCCAGCCATTGG - Intergenic
1005840259 6:29740572-29740594 CTGTGAACACAGGCAGGCAGTGG + Intergenic
1006786610 6:36672003-36672025 CTGTGAACACAGGCCACCTGAGG - Intergenic
1007837025 6:44681856-44681878 CTGGCTACCCAGGCAGCCTATGG + Intergenic
1012332092 6:98004857-98004879 GTGTGCAGACAGGGAGTCTAAGG - Intergenic
1012530193 6:100226390-100226412 CTTTGCTCCCAGGCAGCCAAGGG + Intergenic
1013161163 6:107546575-107546597 ATGTGCACACAGAAAGCCTCTGG + Intronic
1013992048 6:116265189-116265211 CTGTGCACACAGTCACCATCTGG - Intronic
1016490369 6:144593639-144593661 GTCTGGAGACAGGCAGCCTAAGG - Intronic
1019526187 7:1481558-1481580 CACTGCACACAGGCAGCCCCAGG - Intronic
1019619662 7:1985399-1985421 CTGTGCACAGATGCAGACCACGG + Intronic
1019690713 7:2409817-2409839 CTGTGCACAGAGGCAGGCGAGGG - Intronic
1019729577 7:2622745-2622767 CTGTGCTCACAGGGACCCTGTGG + Intergenic
1020271405 7:6598629-6598651 CTGTGCACACAGGCAGCCTAAGG + Intronic
1024766653 7:52668542-52668564 CTGAGGACCCAGGCAGCCTGGGG + Intergenic
1024984018 7:55180519-55180541 CTGTGCCCCCAGGCTCCCTATGG - Intronic
1026143261 7:67724029-67724051 AGGTGCACACAGCCTGCCTAGGG - Intergenic
1026275752 7:68874722-68874744 CAGTGCACAGAGGCATCCTTGGG - Intergenic
1027575201 7:79922442-79922464 CTGTGCACTCAGCCAGACTCAGG + Intergenic
1029611554 7:101629274-101629296 CCATGCAGACAGGCAGGCTATGG + Exonic
1033077493 7:138263167-138263189 CTGCCCACACAGCCAGCCTCTGG + Intergenic
1033661613 7:143406989-143407011 GTGTGCACGCAGTCAGCCTGAGG + Intronic
1033776514 7:144617685-144617707 CAGAGCAAACAGGCAACCTACGG + Intronic
1034548182 7:151802619-151802641 CTGGGCACACAGATAGCCTGGGG - Intronic
1035072829 7:156157516-156157538 CTGTGCAAGGAGGCAGCCTCTGG + Intergenic
1035223576 7:157421022-157421044 CCGTCCACAGAGGCAGCCTTGGG - Intergenic
1035483658 7:159205878-159205900 CTATGCACTCAGACAGCTTATGG + Intergenic
1035993219 8:4515782-4515804 CAGTGCACACAGGCCGTCTTTGG - Intronic
1038494065 8:27989601-27989623 ATGTGCACACACACAGCCTTGGG + Intronic
1038703757 8:29875171-29875193 CTGTCCAGAGAGGCACCCTAAGG - Intergenic
1039977820 8:42382277-42382299 CTGTGCAGGCAAGCAGCCTTGGG - Intergenic
1040387352 8:46922475-46922497 CAGGGCACACAGGCTGCCTTTGG - Intergenic
1040919870 8:52604517-52604539 CTGGGCACACTGGCAGCCTCGGG + Intergenic
1044714778 8:95090198-95090220 CTGTGCACAGAGGCAGCTGTGGG - Intronic
1045461258 8:102427606-102427628 AAGTACACACAGGCAGCCTTGGG - Intergenic
1046978463 8:120310613-120310635 CTTTGCACAAAGGCATCCTGAGG + Intronic
1047378999 8:124338826-124338848 CTGTGTACTCAGGCAGCTTTAGG - Intronic
1049000070 8:139819537-139819559 CAGTGCACAGAGGCGGCATATGG + Intronic
1049263253 8:141651289-141651311 ATGTACACAAAGGCTGCCTAGGG + Intergenic
1049426888 8:142541726-142541748 CTGAGGACACAGGAACCCTAGGG + Intronic
1049685708 8:143938523-143938545 GTGAGCACACAGGCAGCATGGGG + Intronic
1049979757 9:893114-893136 CCGTGCCCACAGGGAGTCTACGG - Intronic
1049995109 9:1027047-1027069 CTGAGCACACAGGAAGGCTCAGG + Intergenic
1057210375 9:93198099-93198121 CTGTACACCCAGGCAGCCAGGGG + Intronic
1057292954 9:93818857-93818879 CTGTGCACACACGCAGGCCTTGG - Intergenic
1057999125 9:99847580-99847602 CAGTGCTGACAGGCAGGCTAAGG - Exonic
1061804865 9:133132276-133132298 CTGTGCAGACAGGCAGGATCTGG + Intronic
1062255103 9:135617155-135617177 CTGAGGGCACAGGCAGCCTTGGG + Intergenic
1185508985 X:648684-648706 CTGTGGACACTGGCTGCCTTTGG + Intronic
1186752027 X:12631171-12631193 CTGTGCACCCAGGCAGTGCAGGG + Intronic
1188342015 X:29014395-29014417 GTGTGCACACACACACCCTAGGG - Intronic
1190901513 X:54678646-54678668 CAGAGCAAACAGGCAACCTAGGG - Intergenic
1192905229 X:75544281-75544303 CTATGCACTCTGGCAGCCAAAGG - Intergenic
1194526378 X:94982935-94982957 CTGTGCACAGAGGGAGCATTTGG + Intergenic
1197271254 X:124427002-124427024 CAGTGCACACAGACAGCTTCTGG - Intronic
1198294336 X:135271023-135271045 CTGTACTCACAAGCAACCTATGG - Intronic