ID: 1020274598

View in Genome Browser
Species Human (GRCh38)
Location 7:6616407-6616429
Sequence GCTCTGAGAAGGCCGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020274598_1020274608 20 Left 1020274598 7:6616407-6616429 CCTGCTGGCGGCCTTCTCAGAGC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1020274608 7:6616450-6616472 TGGAAGGGCGCCAGGCGCAGTGG 0: 1
1: 0
2: 7
3: 112
4: 974
1020274598_1020274607 12 Left 1020274598 7:6616407-6616429 CCTGCTGGCGGCCTTCTCAGAGC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1020274607 7:6616442-6616464 CAATAGAATGGAAGGGCGCCAGG No data
1020274598_1020274606 5 Left 1020274598 7:6616407-6616429 CCTGCTGGCGGCCTTCTCAGAGC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1020274606 7:6616435-6616457 AGGAAGGCAATAGAATGGAAGGG No data
1020274598_1020274605 4 Left 1020274598 7:6616407-6616429 CCTGCTGGCGGCCTTCTCAGAGC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1020274605 7:6616434-6616456 CAGGAAGGCAATAGAATGGAAGG No data
1020274598_1020274603 0 Left 1020274598 7:6616407-6616429 CCTGCTGGCGGCCTTCTCAGAGC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1020274603 7:6616430-6616452 AGGCCAGGAAGGCAATAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020274598 Original CRISPR GCTCTGAGAAGGCCGCCAGC AGG (reversed) Intronic
900171802 1:1273061-1273083 GCACTGAAAAGGACGCCAGGAGG + Intronic
900771999 1:4552696-4552718 ACTCTGAGAAGGCTGCCAAGGGG - Intergenic
901494139 1:9611864-9611886 GCTCGGAGGAGGCCGCCACCTGG + Exonic
901760279 1:11466684-11466706 GCTCAGAAAAGTCAGCCAGCAGG + Intergenic
902882251 1:19380166-19380188 CCTCTGAGAAAGCTGCCTGCGGG - Intronic
904425556 1:30420520-30420542 GCTCAGAGAAGGTCGGCAACTGG + Intergenic
905207510 1:36351319-36351341 CTGCTGAGAAGGCCTCCAGCTGG + Intronic
906147515 1:43568817-43568839 GCTGGGAGAAGGCAGCCAGGAGG + Intronic
907515535 1:54991094-54991116 GCTCTGAGGGGGCCGACAGCTGG + Intronic
909144219 1:71908563-71908585 GCTCTGAGAGGTCCTCCAACTGG + Intronic
909380561 1:74993257-74993279 GCTCTGAGCAGGAAGCAAGCTGG + Intergenic
915472406 1:156133872-156133894 GCTCTGGGAAGGCCTCCAAGAGG - Intronic
915567793 1:156725967-156725989 GGTCTCAGGAGGCCGCCAGAGGG - Intronic
922100449 1:222473907-222473929 GGCCTGGGAAGGCCGCCAGGAGG + Intergenic
923458411 1:234186454-234186476 GCTCTGAGAAGGAGACAAGCTGG + Intronic
1066616325 10:37298703-37298725 GCTCTGGGAAGGCTGCCTGAGGG + Intronic
1066653209 10:37678986-37679008 GCTCTGAGAAGTACCCCAGGAGG - Intergenic
1068320678 10:55410276-55410298 GGACTGAGAAGGAGGCCAGCTGG + Intronic
1071504990 10:86226813-86226835 GCTCAGGGAGGACCGCCAGCTGG - Intronic
1072539917 10:96390481-96390503 GCTCTGAGAAGGCTGCCATCTGG + Intronic
1075259376 10:120949496-120949518 GCTGTCAGAAGGCAGCCAGGCGG + Intergenic
1075701829 10:124474879-124474901 GCCCTGGGAAGGAGGCCAGCAGG - Intronic
1075795586 10:125117231-125117253 GCACTGGGATGGCCGCCAGCTGG + Intronic
1076055378 10:127368150-127368172 GCTCTGCCAAGGCCTCCAGACGG - Intronic
1076497605 10:130907205-130907227 GCTGTGAGAACGCAGCCTGCAGG + Intergenic
1077606482 11:3616125-3616147 GCTCTGACCAGGGCCCCAGCAGG - Intergenic
1083176369 11:60952345-60952367 GCTCTAAGGAGGCCAGCAGCGGG - Intronic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1084981594 11:72831837-72831859 GCTCAGAGAAGCCCTGCAGCTGG + Intronic
1085517938 11:77122224-77122246 GCTCTCAGGAGGCTTCCAGCTGG + Intronic
1091447674 12:553378-553400 GCTTGGAGAAGGGGGCCAGCAGG - Exonic
1092166247 12:6344072-6344094 GCTCTGTGAAGGGTACCAGCAGG - Intergenic
1092745976 12:11672946-11672968 GCTCTGGGAAGGCTGCCTGTTGG + Intronic
1098387629 12:69935607-69935629 GCTCTGAAAAGACAGGCAGCCGG + Intronic
1099895599 12:88642797-88642819 TCTATGAGAAGGCTGCCATCTGG + Intergenic
1102164653 12:110796724-110796746 GGTCTGAGAAGGCAGTGAGCTGG + Intergenic
1102220084 12:111188435-111188457 GCTCTGTGAAGGAAGCCACCAGG + Intronic
1102727087 12:115075182-115075204 GCTCAGAGAAGCCCCTCAGCTGG - Intergenic
1106586044 13:31056823-31056845 GCTCCCAGATGGCCACCAGCTGG - Intergenic
1111888688 13:94054566-94054588 GCTCTAAGGAGGCCAGCAGCTGG - Intronic
1113638521 13:111939413-111939435 GCTCTGAGACGCCACCCAGCAGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1117727420 14:58687782-58687804 GGGCTGCGAGGGCCGCCAGCAGG + Intergenic
1118322749 14:64762963-64762985 GCTCTGAGAACTCCCTCAGCAGG - Intronic
1123219482 14:106842809-106842831 GGTATGGGAAGGCCACCAGCAGG - Intergenic
1124338712 15:28876283-28876305 GCACTGAGAAGGCTGTGAGCGGG + Intergenic
1124686452 15:31786774-31786796 GCTCTGAGAAGGCAGCTATGTGG + Intronic
1125211808 15:37225604-37225626 AGTCTGAGAAGGCCACCAGGAGG + Intergenic
1128061945 15:64740908-64740930 GCTCTGTGCAGGCCGCCCGGGGG + Exonic
1129688546 15:77700165-77700187 GCCCTGAGGAGGCCGGGAGCAGG - Intronic
1130100987 15:80893988-80894010 GCTCTGGGATGGGCCCCAGCTGG + Intronic
1131253351 15:90845307-90845329 TCTCTGAGAAAGCCTTCAGCTGG - Intergenic
1132796817 16:1728577-1728599 GCTCTGTGAAGGCCGTCTGGGGG - Intronic
1132796827 16:1728635-1728657 GCTCTGTGAAGGCCGTCTGGGGG - Intronic
1132796839 16:1728691-1728713 GCTCTGTGAAGGCCGTCTGGGGG - Intronic
1132796849 16:1728749-1728771 GCTCTGTGAAGGCCGTCTGGGGG - Intronic
1132796868 16:1728865-1728887 GCTCTGTGAAGGCCGTCTGGGGG - Intronic
1132853132 16:2033666-2033688 GCTCTGTGCTGGCCGCCGGCAGG + Intronic
1136067902 16:27771043-27771065 GCTCTGGGAAGGCCTCCAGGAGG - Intronic
1138279306 16:55760917-55760939 GCCCCAAGAAGGCCGGCAGCCGG + Intergenic
1138303770 16:55956026-55956048 CCCCTGAGAATGCAGCCAGCTGG - Exonic
1142383395 16:89746790-89746812 GTTCTGAGAAGGCCACGAGAGGG + Intronic
1142961020 17:3552707-3552729 GCTCAGAGAAGGCAGCCTGACGG + Intronic
1144889290 17:18484815-18484837 TCTCAGAGAAGTCCGACAGCAGG - Intronic
1145052939 17:19678254-19678276 GCTCTGAGAAGGGGACCAGTGGG - Intergenic
1145112850 17:20179466-20179488 GCACTGAGAAGGCAGGCAGCTGG + Intronic
1145142919 17:20459481-20459503 TCTCAGAGAAGTCCGACAGCAGG + Intronic
1145996638 17:29108629-29108651 GCTCTGGGAAACCCTCCAGCTGG + Intronic
1148441603 17:47714436-47714458 GCTCTTAGAAGGCAACCAGGGGG - Intergenic
1151804824 17:76398805-76398827 GCTCTGGAAGGGCAGCCAGCAGG - Intronic
1151929689 17:77224473-77224495 GCTCAGAGAGGGCAGGCAGCAGG - Intergenic
1152123419 17:78432646-78432668 GTCCTGAGAAGGCCCCCAGGAGG - Intronic
1152713733 17:81888202-81888224 GCTTTGACCAGGCCCCCAGCTGG + Intronic
1152751694 17:82065381-82065403 GCCCTGAGCAGGCCGCCCGGCGG + Exonic
1156450788 18:37265546-37265568 CCTCTGGGAAGGCTGCCAGGGGG + Intronic
1158563928 18:58538161-58538183 GCTCTGAGAAAGCTGGCATCTGG + Exonic
1160023886 18:75203901-75203923 GCACTGAGACGGGCTCCAGCTGG - Intronic
1160551434 18:79696112-79696134 GCTCTGAGGAGGGCGGCTGCAGG + Intronic
1160567769 18:79797954-79797976 GCCCCGAGGAGGCCGCCGGCCGG + Intergenic
1163665156 19:18599775-18599797 GCACTGAGCAGGTGGCCAGCAGG + Exonic
1165953622 19:39488603-39488625 GCTGTTTGAAAGCCGCCAGCGGG - Exonic
1166043637 19:40217380-40217402 GCTCTGAGAGTGCCGGCCGCGGG - Intronic
1167135502 19:47613085-47613107 CCTCTGAGAAGGAAGTCAGCCGG - Intronic
1167802921 19:51757043-51757065 GCTCTGAGAATGCTCCCAGTTGG - Intronic
925901222 2:8510768-8510790 GCTGTGACAAAGCCGCCAGCTGG - Intergenic
926684567 2:15689187-15689209 GCTCTGAGAGGGCAGAAAGCTGG - Intergenic
926883817 2:17578617-17578639 GCTCTCAGAAGGCCCACGGCTGG + Intronic
927949201 2:27155966-27155988 GCTCTGTGGAGGGAGCCAGCAGG - Exonic
934665221 2:96164763-96164785 GCTCTGGGAGCGCCGCCACCAGG - Intergenic
934943477 2:98519457-98519479 GCTCTGGGAAGAAAGCCAGCAGG + Intronic
938608475 2:132921594-132921616 GCTCAGAGAAGGCCTCCTGGAGG + Intronic
940775169 2:157876616-157876638 GCTATGAGCGCGCCGCCAGCGGG + Intergenic
940984924 2:160043358-160043380 ACCCTGAGAAGGCAGCCAGCAGG - Intronic
945214741 2:207421493-207421515 GCTTTGAGGAGGTTGCCAGCAGG - Intergenic
1169327418 20:4686882-4686904 ACTCCGGGAGGGCCGCCAGCGGG + Intronic
1171346697 20:24470694-24470716 GCTTTGAGGAGGCGGCCAGAGGG + Intronic
1174037700 20:47678441-47678463 GCTCAGAGAAGGTCCCCAACTGG + Intronic
1176202495 20:63868451-63868473 ACTGCCAGAAGGCCGCCAGCAGG - Intronic
1178160577 21:29908420-29908442 GCTCTAAGAAGAGCACCAGCAGG - Intronic
1179487330 21:41718807-41718829 GGCCTGAGAAGGGAGCCAGCTGG + Intergenic
1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG + Intronic
1179887926 21:44322319-44322341 GCTCTGGGCAGACCACCAGCAGG - Intronic
1180178101 21:46099789-46099811 GCTCTTAGAAGGGCGGCATCTGG + Intronic
1181267805 22:21641451-21641473 ACTCTGAGAAGGCGGCAAGAAGG + Intergenic
1183332307 22:37228216-37228238 CCTCCCAGAAGGCCCCCAGCTGG - Intronic
1183842368 22:40510016-40510038 GCTCTGCCAAGGCCCCCAGTGGG + Intronic
1184707432 22:46224242-46224264 GCTCTGGAAAGCCCGTCAGCAGG - Intronic
1185249422 22:49792280-49792302 GCTGTGAGGAGGTTGCCAGCAGG - Intronic
950006475 3:9694799-9694821 GCTCTGAGTTGGCCATCAGCAGG + Intronic
950493643 3:13320962-13320984 GCTCTGCTCACGCCGCCAGCGGG + Intronic
951306457 3:21068887-21068909 GCTCTGGGAACACCGGCAGCAGG - Intergenic
953389578 3:42526591-42526613 GGTCTGAGAAGGGCGCCTGAGGG - Intronic
954402852 3:50328085-50328107 GCCCTGACATGGGCGCCAGCGGG - Exonic
961746808 3:129068808-129068830 GGTCTGTGAGGGCTGCCAGCAGG + Intergenic
962879391 3:139561929-139561951 GCAATGAAAAGGCCACCAGCTGG - Intronic
966808837 3:183825920-183825942 GCTGGGAGCAGTCCGCCAGCCGG + Intergenic
967762479 3:193241280-193241302 GCTCTGAGACGCCCGCACGCCGG - Exonic
968489634 4:883123-883145 GCTCTGAGGATGCCGCTTGCCGG - Intronic
969489669 4:7491882-7491904 GCTGTGGGAAGGCAGACAGCAGG + Intronic
971196220 4:24473122-24473144 GGTCGGAGAAGGCGGCCGGCCGG - Intergenic
972148970 4:36064982-36065004 GCTGTGAGAAGGCAGTGAGCTGG + Intronic
975647978 4:76564433-76564455 GCTCTGAGAATGGTCCCAGCAGG - Intronic
977586291 4:98779051-98779073 GCCCTGGGAAGGCCCACAGCAGG + Intergenic
983112679 4:163772552-163772574 GCTCCTAGAAGGCTGTCAGCAGG + Intronic
983904253 4:173168591-173168613 GCTCTGCGGTGGCCGCCAGAGGG + Intergenic
985580421 5:693038-693060 GCTTTGCAAAGGCCGCGAGCGGG - Intronic
985595083 5:784428-784450 GCTTTGCAAAGGCCGCGAGCGGG - Intergenic
987359162 5:17091300-17091322 GCTCTGAAACGGTCCCCAGCGGG - Intronic
990130832 5:52581082-52581104 GCCCTGGGAAGGCAGCCAACAGG + Intergenic
992210633 5:74476367-74476389 GCTCTAAGGAGGAAGCCAGCTGG - Intergenic
994329179 5:98486301-98486323 GCTCTGAGAAGGCCTCTGGCAGG - Intergenic
998059174 5:139105655-139105677 CCTCTGAGCAGGCCGCCGGGAGG - Intronic
999376267 5:151088358-151088380 ACTCTGAGAAGGCAGGAAGCGGG - Intronic
1001593968 5:172886017-172886039 GCTCGGTGATGGCCGCCTGCTGG + Intronic
1002175803 5:177400441-177400463 GCGGCGAGATGGCCGCCAGCAGG + Exonic
1002401260 5:178992679-178992701 GGGCTGAGAAGGCCGCCAAGAGG + Intronic
1004133639 6:12945640-12945662 GCTCTGAGAAGTCCTGCAGCAGG - Intronic
1006364774 6:33608849-33608871 CCCCTGAGAATGTCGCCAGCAGG + Intergenic
1016184133 6:141179441-141179463 ACACTGAGAAGGCTGCCAGGAGG - Intergenic
1016879659 6:148898514-148898536 AATCTGAGAAAGCAGCCAGCTGG - Intronic
1016917792 6:149260715-149260737 GCGCTGAGAAGGGAGCCTGCTGG + Intronic
1017767991 6:157622697-157622719 GTTCTGAGAAGGCTGAGAGCTGG - Intronic
1017853540 6:158328055-158328077 GCTCTGAGAATGCTGGCAACAGG - Intronic
1017895326 6:158674566-158674588 GCGATGAGAAGGCCGAAAGCAGG - Intronic
1017948352 6:159115179-159115201 GCTCTGAGGAAGGAGCCAGCGGG + Intergenic
1020105238 7:5419704-5419726 GCTCGGAGATCCCCGCCAGCCGG - Intronic
1020274598 7:6616407-6616429 GCTCTGAGAAGGCCGCCAGCAGG - Intronic
1024001943 7:45195504-45195526 ACTCTGCGAAGGCATCCAGCAGG - Intergenic
1024046405 7:45588669-45588691 GCTCGGAAAAGGCAGCCAGGAGG - Intronic
1024374650 7:48623082-48623104 GCTCTGGGAAGTGCTCCAGCAGG - Intronic
1024575934 7:50764152-50764174 TCTCTGAGGAGGCTACCAGCAGG - Intronic
1029629645 7:101742487-101742509 ACTCTGAGAAGGAAGCCCGCGGG + Intergenic
1029701435 7:102248993-102249015 GCCTGGAGAAGGCCGCCAGCCGG + Exonic
1035573924 8:692491-692513 GCCCCGAGAACGCCTCCAGCGGG - Exonic
1036615177 8:10382227-10382249 GCTCTTCCAAGGCCTCCAGCAGG + Intronic
1037994193 8:23340850-23340872 GCTCTGTGCAGGCTGCCTGCAGG + Intronic
1039268967 8:35859786-35859808 TCTCCCAGAAGGCCTCCAGCAGG - Intergenic
1041346424 8:56902921-56902943 GCTCTGTGAAAGACTCCAGCTGG + Intergenic
1041456997 8:58071808-58071830 AACCTGAGAATGCCGCCAGCTGG - Intronic
1042039248 8:64575731-64575753 GCGCTGAGAAGGCTGCCTCCCGG + Intergenic
1044427405 8:92068435-92068457 GCTCTGTGCAGGCAGCCATCTGG + Intronic
1046924125 8:119768145-119768167 GCTCTCAGAAGGGCTCCAGCTGG - Intronic
1048518575 8:135133268-135133290 GCTCTGAGAAGTCCTGCAGCAGG + Intergenic
1049335224 8:142080731-142080753 GCTCTGAGAAGTCCTGCAGCCGG + Intergenic
1050278710 9:4027906-4027928 GCTCTGAGCTGGCCTTCAGCTGG - Intronic
1051528482 9:18074151-18074173 GGTCTGAGATGCCCACCAGCTGG + Intergenic
1052999322 9:34568854-34568876 GCTCTGAGAGGGGGGTCAGCAGG + Intronic
1053265342 9:36709014-36709036 GCTGTGTGAAGGACACCAGCAGG + Intergenic
1055422747 9:76161298-76161320 GCCCTCAGCAGGCCGCCTGCAGG + Intronic
1057891615 9:98874212-98874234 GGTCTGGGAAGGCAGCCAGGAGG + Intergenic
1061390512 9:130315081-130315103 GCTCTGAGAGCGCCTCCTGCAGG + Intronic
1061615558 9:131776503-131776525 GATCTAAGAAGGCAGCCAGCAGG + Intergenic
1061858488 9:133455926-133455948 GTCCTGAGAAGGCTTCCAGCTGG + Intronic
1062120411 9:134831072-134831094 GCTCTCAGAAGGCAGCCCGTGGG + Intronic
1062303927 9:135891211-135891233 GCTCTGTGACTGCAGCCAGCTGG - Intronic
1189002016 X:36957744-36957766 GGTCTGCGGAGGCCGCCGGCCGG - Intergenic
1189332500 X:40152456-40152478 CCTCTGAGCTGGCAGCCAGCGGG + Intronic
1189975938 X:46461426-46461448 GCTCTGAGAAGCCCTCCTGCTGG + Intronic
1189983129 X:46530274-46530296 GCTCTGAGAAGCCCTCCTGCTGG - Intronic
1200164494 X:154026835-154026857 GCTATGACAAGCCCACCAGCAGG + Intronic
1200238167 X:154479085-154479107 GGTCTCAGAAGGCCCCCGGCAGG - Exonic