ID: 1020274724

View in Genome Browser
Species Human (GRCh38)
Location 7:6617085-6617107
Sequence TGGGTGGCCCGAGGCAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 1, 2: 1, 3: 39, 4: 436}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020274713_1020274724 29 Left 1020274713 7:6617033-6617055 CCCGTTGCGGGGGACAGTCCTAT 0: 1
1: 0
2: 0
3: 5
4: 28
Right 1020274724 7:6617085-6617107 TGGGTGGCCCGAGGCAGAGGTGG 0: 1
1: 1
2: 1
3: 39
4: 436
1020274717_1020274724 11 Left 1020274717 7:6617051-6617073 CCTATAGTTGCAGCAGGTATGGA 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1020274724 7:6617085-6617107 TGGGTGGCCCGAGGCAGAGGTGG 0: 1
1: 1
2: 1
3: 39
4: 436
1020274712_1020274724 30 Left 1020274712 7:6617032-6617054 CCCCGTTGCGGGGGACAGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1020274724 7:6617085-6617107 TGGGTGGCCCGAGGCAGAGGTGG 0: 1
1: 1
2: 1
3: 39
4: 436
1020274714_1020274724 28 Left 1020274714 7:6617034-6617056 CCGTTGCGGGGGACAGTCCTATA 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1020274724 7:6617085-6617107 TGGGTGGCCCGAGGCAGAGGTGG 0: 1
1: 1
2: 1
3: 39
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020274724 Original CRISPR TGGGTGGCCCGAGGCAGAGG TGG Intronic
900296844 1:1956188-1956210 TGGGTGTCCCAAGGCTCAGGTGG - Intronic
900371760 1:2335385-2335407 CGGATGGGCAGAGGCAGAGGAGG + Intronic
900392311 1:2438989-2439011 TGGGTGGCTCCAGGTAGAAGTGG + Intronic
900479845 1:2892759-2892781 TGTGTGGCCAGATGCAGATGTGG - Intergenic
900932736 1:5747224-5747246 AGGCAGGCCCGTGGCAGAGGTGG - Intergenic
900987699 1:6082868-6082890 TGGCTGGCCCCAGGCAGGAGGGG - Intronic
901206589 1:7501068-7501090 GGGGTGGCGCGTGGCACAGGTGG - Intronic
901325415 1:8362454-8362476 TGGGAAGCTTGAGGCAGAGGTGG + Intronic
901686413 1:10946040-10946062 TGGGTGGCCTGAGCTGGAGGAGG - Intergenic
901769767 1:11524306-11524328 TGAGTGTCCAGGGGCAGAGGTGG + Intronic
901807467 1:11747639-11747661 GTGGTGGCCCAAGGAAGAGGGGG - Intronic
901853569 1:12030476-12030498 TGGGGAGACCGAAGCAGAGGGGG + Intronic
902090073 1:13896102-13896124 TAGGTAGCAGGAGGCAGAGGTGG - Intergenic
902286777 1:15412224-15412246 TGGGTGGGCAGACGCAGGGGTGG + Intronic
902654991 1:17860846-17860868 TGGGTGGCTTGATGAAGAGGTGG - Intergenic
903178669 1:21594825-21594847 TGGGTGGCCTGAGGCATCAGAGG + Intergenic
903185615 1:21627197-21627219 AGGGTGGCCCTAGGCAGCAGCGG - Intronic
904207532 1:28864584-28864606 TGGGTGGGTGGAGGAAGAGGTGG + Intergenic
904469394 1:30726952-30726974 TGGCTGGCCTGTGACAGAGGGGG - Intergenic
904975290 1:34451542-34451564 TGGTTGGCCCCTGGCAGAGCAGG - Intergenic
905852202 1:41282772-41282794 TGAGGACCCCGAGGCAGAGGAGG + Intergenic
906533284 1:46536066-46536088 AGGGTGCCCCGATGGAGAGGAGG + Intergenic
906556957 1:46721711-46721733 TGGCTGGCCCGAGGGTGGGGTGG + Intergenic
907074865 1:51568958-51568980 TGGGTGGCGGGGGGCTGAGGCGG - Intergenic
909330222 1:74400469-74400491 TGGGCGGCCTGAGGCACAGGTGG + Intronic
912326588 1:108769289-108769311 TGGGGTGGCAGAGGCAGAGGAGG + Intronic
912771122 1:112465078-112465100 TGGGTGGGCTGAGGGAGCGGGGG - Intergenic
913222152 1:116667896-116667918 AGGGTGGCCCGGGGCACCGGAGG + Intergenic
913283457 1:117207446-117207468 AGGGTGGGCAGAGGAAGAGGGGG - Intronic
915943029 1:160130747-160130769 TGAGTGCCCCAAGGCAGGGGTGG - Intronic
915963393 1:160285199-160285221 TTGGTTACCCGAGGCAGAAGAGG - Intronic
915972427 1:160364095-160364117 TGGGATGCCAGATGCAGAGGAGG + Intergenic
916107987 1:161444432-161444454 TGGGTGGCGTGAGACAAAGGTGG - Intergenic
916109573 1:161451814-161451836 TGGGTGGCGTGAGACAAAGGTGG - Intergenic
916112746 1:161466605-161466627 TGGGTGGCGTGAGACAAAGGTGG - Intergenic
916651687 1:166839660-166839682 CGGCTGGGCCGCGGCAGAGGCGG + Intronic
919910199 1:202106470-202106492 TGAGAGGCCCGGGGCAGGGGTGG - Intergenic
920037314 1:203074800-203074822 TGGGTGCCCTGTGGCAGAGATGG + Intronic
920278158 1:204823978-204824000 TGGCTGGCCCTTGGCAGTGGTGG + Intergenic
920379784 1:205528851-205528873 GGGGTGGCCCAGGGCAGTGGAGG - Intronic
920402015 1:205681880-205681902 TGGGAGGCAGGAGGAAGAGGGGG - Intergenic
920721943 1:208395816-208395838 TGTGTGCCTGGAGGCAGAGGAGG + Intergenic
921171325 1:212552533-212552555 AGGGTGGCCTTAGGTAGAGGAGG + Intergenic
921914647 1:220593822-220593844 TGGGTAGGCCCAGGCAGGGGTGG + Intronic
921944698 1:220878833-220878855 TGGGAGGCACGAGGCGGACGCGG + Intergenic
923036271 1:230287187-230287209 TGGGTGGCAGGATGCAGCGGTGG - Intergenic
923385261 1:233459841-233459863 GGGCTGGTCAGAGGCAGAGGGGG - Intergenic
923579975 1:235200211-235200233 TTGGGAGGCCGAGGCAGAGGTGG + Intronic
923627821 1:235628454-235628476 TGGGTGCCCTGAAGCGGAGGAGG + Intronic
923628116 1:235630770-235630792 TGGGTGGCCAGAGGCTGAGATGG + Intronic
923745892 1:236700009-236700031 TAGGTGGCCAGAGGCAGCTGTGG - Intronic
1063245305 10:4211732-4211754 TGAGTGGGCCGAGGAGGAGGAGG + Intergenic
1064427199 10:15240115-15240137 TTGGGAGGCCGAGGCAGAGGCGG + Intronic
1066351712 10:34642368-34642390 TGGGTGGATCAAGGAAGAGGAGG - Intronic
1067282415 10:44882313-44882335 TGGCTGGCCACAGGCAGGGGAGG - Intergenic
1067338496 10:45382696-45382718 TGGGAAGCCCGGGGCAGAAGGGG - Intronic
1067395235 10:45909645-45909667 TGGGTGACCAGAGGCAGTGAAGG + Intergenic
1067484530 10:46635475-46635497 TGGTTGGGCCGGGGCTGAGGAGG - Intergenic
1067588649 10:47492259-47492281 TGCCTTGCCCGAGTCAGAGGGGG + Intergenic
1067610229 10:47706172-47706194 TGGTTGGGCCGGGGCTGAGGAGG + Intergenic
1067635777 10:48000350-48000372 TGCCTTGCCCGAGTCAGAGGGGG + Intergenic
1067863557 10:49878769-49878791 TGGGTGACCAGAGGCAGTGAAGG + Intronic
1068566073 10:58577021-58577043 TGTCGGGCCAGAGGCAGAGGGGG + Intronic
1069426110 10:68290066-68290088 AGGGTGGCTTGGGGCAGAGGGGG + Intronic
1069761356 10:70813788-70813810 TGGCTGGTCAGAGGCAGAGGAGG - Intergenic
1069896736 10:71684744-71684766 TGAGTGGGCTGAGGCAGAGAGGG + Intronic
1069942337 10:71964317-71964339 TGGGTGGGGTGAGGAAGAGGAGG + Intergenic
1070132334 10:73664357-73664379 TGCCTTGCCCGAGTCAGAGGGGG + Intergenic
1070664554 10:78333864-78333886 TGGGTGGCAGGGGGCAAAGGGGG + Intergenic
1070797075 10:79223091-79223113 GGGGTGGGCAGAGGCAGAGAGGG - Intronic
1070941407 10:80351465-80351487 TGGGTGGACTTAGGCAGGGGAGG - Intronic
1070948538 10:80412723-80412745 TGGTTGGCCTGGGTCAGAGGGGG + Intronic
1071430284 10:85601700-85601722 TGGGTAGCCTGGGGCTGAGGAGG - Exonic
1072609792 10:97010618-97010640 TGGGTGGCCAGAGGGAGGGTGGG + Intronic
1072733260 10:97862598-97862620 TGGGTAGGCTGAGGAAGAGGAGG + Intronic
1072805392 10:98420830-98420852 TGGGCGACCCCAGGCAGAGGAGG - Intronic
1073288761 10:102403114-102403136 TGGGTGGCCCGAGGCCGGCCCGG + Exonic
1074454585 10:113586256-113586278 TGGGTGGCCAGTGGCAGGGCTGG + Intronic
1075444726 10:122505487-122505509 TGGGTGACTCGAGACAGAGCAGG - Intronic
1075588258 10:123672730-123672752 TGGTTTGCCCGAGGTAGAGGAGG + Intronic
1076109689 10:127851160-127851182 TGGGCGGCTCGGGCCAGAGGAGG + Intergenic
1076567220 10:131407033-131407055 AGGCTGTCCCCAGGCAGAGGTGG - Intergenic
1076609331 10:131711347-131711369 AGGATGGGCTGAGGCAGAGGAGG - Intergenic
1076700996 10:132272630-132272652 ACGGTGGCCAGAAGCAGAGGAGG - Intronic
1076733240 10:132448520-132448542 TGGGTGGGGCCAGGCAGAGCTGG - Exonic
1076810816 10:132885548-132885570 TGGGGAGGCCCAGGCAGAGGGGG + Intronic
1076830559 10:132992311-132992333 AGGCTGGCGGGAGGCAGAGGAGG + Intergenic
1076850545 10:133090312-133090334 CGGGTGGCCCCGGGCCGAGGAGG - Intronic
1077221922 11:1421743-1421765 TGGGTGCCCCCAGACTGAGGAGG + Intronic
1077231241 11:1459029-1459051 GGGGGGGCCAGAGCCAGAGGGGG - Intronic
1078010272 11:7568147-7568169 TAGGTGTCACGAGGCAGAGTTGG - Intronic
1078527489 11:12111407-12111429 TGGCTGGCCCCGGGGAGAGGTGG + Intronic
1080273019 11:30470843-30470865 AGGATGGCTAGAGGCAGAGGAGG - Intronic
1080285469 11:30606396-30606418 TGGCTGGCCAGAGGAGGAGGAGG - Intergenic
1080540540 11:33259784-33259806 CGGGGGGCGGGAGGCAGAGGGGG - Intronic
1081649310 11:44812996-44813018 TGGGTGGCCCCAGAAAGAGCAGG - Intronic
1082000837 11:47393100-47393122 GGGGGAGCCCCAGGCAGAGGTGG + Intergenic
1083609668 11:63998906-63998928 AGGGTGGACCGGGGCAGGGGCGG + Intronic
1083614508 11:64019566-64019588 CAGGAGGCCCGAGGCACAGGTGG + Intronic
1083768357 11:64853068-64853090 TCAATGGCCCCAGGCAGAGGAGG + Exonic
1083920459 11:65779399-65779421 TGGGTGGGCGGAGGCAGAGCAGG + Exonic
1084084894 11:66850469-66850491 AGGGAGGCCAGAGTCAGAGGAGG + Intronic
1084365192 11:68693096-68693118 GGGGCGGGCTGAGGCAGAGGTGG - Intergenic
1084447730 11:69213381-69213403 GGGGTGGGGCGGGGCAGAGGTGG + Intergenic
1087534396 11:99425185-99425207 TGGGTGGCCATAGGCAGACCTGG + Intronic
1089401388 11:118166559-118166581 TGGGTGGGCAGGGGTAGAGGAGG - Exonic
1089603707 11:119629571-119629593 TGGGTGGACAGAGGCAGGGTGGG + Intronic
1089743829 11:120603243-120603265 TGTGTGGCCTCAGGGAGAGGTGG - Intronic
1090204610 11:124877504-124877526 TGGGTGGCCTGAGGGAGAGCAGG - Exonic
1090327822 11:125904341-125904363 TGGGTGGCGCGCGGAAGGGGCGG - Exonic
1090636243 11:128692295-128692317 CTGGTGGCCCCAGGCAAAGGGGG + Intronic
1091161572 11:133426574-133426596 TCGGGGGCCTGGGGCAGAGGAGG - Intronic
1091544012 12:1488443-1488465 TTGGGAGGCCGAGGCAGAGGCGG + Intronic
1091634315 12:2185790-2185812 TGTGTGGCCCTGGGCAGAAGCGG + Intronic
1092070433 12:5627288-5627310 TGGGTGGCCTCAGGCAGTGGGGG - Intronic
1093903010 12:24657861-24657883 TTGGGAGGCCGAGGCAGAGGAGG - Intergenic
1095978184 12:47954099-47954121 TGGGTGGGCCTGGGCAGAGGGGG - Intergenic
1096147254 12:49287363-49287385 AGGCTGGCGCGAGGCAGATGAGG - Intergenic
1096412634 12:51388273-51388295 AGAGGGGCCCGAGGCAAAGGAGG - Intronic
1096524530 12:52202684-52202706 TGCGTGGACCTTGGCAGAGGCGG - Intergenic
1097222883 12:57461038-57461060 AGGGTGGTCTGAGCCAGAGGAGG - Intronic
1098254672 12:68605097-68605119 TGGGAGGCTGGAGGCTGAGGTGG + Intergenic
1101186853 12:102289531-102289553 TGGCTGCCCCTTGGCAGAGGGGG + Intergenic
1102058758 12:109916130-109916152 AGGGTGGCCCTAGGTAAAGGAGG - Intronic
1102238718 12:111310411-111310433 GGCGGGGCCCGGGGCAGAGGAGG + Exonic
1102548679 12:113674975-113674997 TGAGTGGCCACAGGGAGAGGTGG - Intergenic
1103587299 12:121965930-121965952 TTGGTGGCCTGAGGCTAAGGTGG - Intronic
1103854693 12:123958463-123958485 AGGAAGGCACGAGGCAGAGGAGG - Intronic
1104120626 12:125795789-125795811 TGGGTGGCCCAAGGCAGCTCCGG + Intergenic
1105775348 13:23654372-23654394 TGGGTGTCCTGGGGCAGGGGCGG - Intronic
1105817727 13:24051904-24051926 GGGGTGGGCCGGGGCTGAGGAGG - Intronic
1105917817 13:24933292-24933314 TGGGCCCCCAGAGGCAGAGGAGG + Intergenic
1106055002 13:26229317-26229339 GGGTTGGGCGGAGGCAGAGGAGG + Intergenic
1110847116 13:80202613-80202635 TGGGTAGTCCCAGGCAGATGGGG + Intergenic
1112738013 13:102443052-102443074 AGGGTGGCCAGAGGAACAGGGGG + Intergenic
1112913972 13:104523092-104523114 TGGCATGACCGAGGCAGAGGAGG - Intergenic
1113163765 13:107414032-107414054 TGGGAGGCCAGAGGCCAAGGTGG - Intronic
1113460620 13:110479598-110479620 TTGGAGCCCCGAGGCAGAGGGGG + Intronic
1113613665 13:111665663-111665685 AGGGTGGCCCAAGGCAGAGAGGG - Intronic
1113788515 13:113015436-113015458 AGGGTGCCCCGATGCTGAGGAGG + Intronic
1113788521 13:113015456-113015478 AGGGTGCCCCGATGCCGAGGAGG + Intronic
1113788528 13:113015476-113015498 AGGGTGCCCCGATGCTGAGGAGG + Intronic
1116997099 14:51335559-51335581 TGGGTGGCCAGGGGCAGATGGGG + Intergenic
1118324107 14:64769841-64769863 TGGCTGGCCAGAGAGAGAGGAGG - Intronic
1119261051 14:73238094-73238116 GGGCTGGACCGATGCAGAGGGGG + Intronic
1120564573 14:86038733-86038755 TGGGTGGCCTGAGGCTTTGGGGG + Intergenic
1121208570 14:92189290-92189312 AGGGTGGCACCAGGCAGAGTTGG + Intergenic
1121333006 14:93059805-93059827 TGGGGGTCCCGAGGCAGGGGTGG + Intronic
1121733288 14:96201358-96201380 AGGGAGGCCAGAGGCAGAGAAGG + Intergenic
1122284441 14:100642324-100642346 TGGGGGGCCCAGGGCAGAAGAGG + Intergenic
1122924308 14:104892654-104892676 TGGGGGGCCGGAGAGAGAGGAGG + Intronic
1122985158 14:105208515-105208537 TGTGGGGCCCCAGGCACAGGTGG - Intergenic
1124416469 15:29476596-29476618 AGGGTGGTCAGGGGCAGAGGTGG - Intronic
1124899096 15:33805957-33805979 ATGGTGGACAGAGGCAGAGGTGG - Intronic
1125602425 15:40923014-40923036 TGGAAGGCCAGAGCCAGAGGAGG + Intergenic
1125716255 15:41821593-41821615 TGGGAAGCCTGAGGCCGAGGGGG - Exonic
1126315243 15:47362725-47362747 TGGCTGGCCTGAGGAAGAGGGGG + Intronic
1126358061 15:47817182-47817204 TAGGTGGCCTGAGTCAGGGGCGG - Intergenic
1128220207 15:65963754-65963776 GGGGTGGTGTGAGGCAGAGGTGG - Intronic
1128225657 15:65999562-65999584 TGGGTGGTAAGAGGCAGAGGTGG - Intronic
1128257849 15:66211615-66211637 GGGGTGCTCCCAGGCAGAGGTGG + Intronic
1128455196 15:67827985-67828007 GGGGTGGCCCGAGGCGGCGCCGG - Intronic
1129253638 15:74321910-74321932 TGCGTGGCCCTTGGCAGATGAGG + Intronic
1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG + Exonic
1129342065 15:74892634-74892656 GGGGTGGCCAGGGGAAGAGGAGG - Intronic
1129735565 15:77959627-77959649 GGGGTAGGGCGAGGCAGAGGTGG + Intergenic
1130512352 15:84600421-84600443 TGGGAGTTCCGCGGCAGAGGAGG + Intergenic
1130651461 15:85764329-85764351 GGGGTGGCCTCAGGCTGAGGAGG + Intronic
1131545737 15:93314358-93314380 TGGGTGGAGTGAGGCAGAGCAGG + Intergenic
1132117936 15:99151236-99151258 TGGGTGGCCTGGGGTGGAGGTGG - Intronic
1132408830 15:101561567-101561589 GGGGAGGCAAGAGGCAGAGGAGG + Intergenic
1132553653 16:563718-563740 CGGGTGGCCCTAGCCACAGGGGG - Exonic
1132659997 16:1057078-1057100 GGGGTGGGGCGAGGCAGTGGTGG + Intergenic
1132680658 16:1140188-1140210 TGTGTGGCGTGAGGCAGGGGTGG + Intergenic
1132690012 16:1178084-1178106 GGGGAGGCCCCAGGGAGAGGGGG - Intronic
1133039847 16:3054839-3054861 TGCATGGCCAGAGGCAGAGATGG + Intronic
1133041061 16:3059877-3059899 TGGGTGGCCTGGGGAGGAGGAGG - Exonic
1133392388 16:5420899-5420921 GGGGTGGAGGGAGGCAGAGGAGG - Intergenic
1133996737 16:10753889-10753911 AGGGTGGCCCGAAGCAGATGGGG + Intronic
1136280689 16:29208694-29208716 TGGGTAGGCTGAGGCAGAGGAGG - Intergenic
1137621245 16:49877787-49877809 CAGCTGGCCAGAGGCAGAGGTGG + Intergenic
1138228797 16:55323538-55323560 TGGGTGGGCGGCGGCAGGGGTGG - Intergenic
1138572396 16:57884283-57884305 TGGGAGGCCGGAGGGAGAGGAGG - Exonic
1139420059 16:66844548-66844570 TCGGGGGTCCGAGCCAGAGGCGG - Intronic
1139420156 16:66844862-66844884 GGGGTGGCCCAGGGCAGCGGGGG + Intronic
1139958589 16:70705081-70705103 TTGGTGACCAGAGCCAGAGGAGG - Intronic
1141703192 16:85651683-85651705 TGGGTGGCCAGAGTCAGAAGAGG - Intronic
1142085048 16:88174630-88174652 TGGGTAGGCTGAGGCAGAGGAGG - Intergenic
1143036930 17:4004803-4004825 CCGGTGGCCGGAGACAGAGGCGG + Exonic
1144090278 17:11850169-11850191 TGGGTGGGAGGAGGCAGAGGTGG + Intronic
1144754668 17:17671829-17671851 TGGGTGAGCAGAGGCAGTGGAGG + Intergenic
1144998704 17:19288649-19288671 GGGGTGGAGCGTGGCAGAGGTGG + Intronic
1145144218 17:20467333-20467355 TGGGTGGCAGGAGACAGGGGTGG - Intronic
1145824253 17:27865158-27865180 TGAGTGGGCTGAGGAAGAGGGGG + Intronic
1145993289 17:29091864-29091886 TGGATGGGCCGTGGGAGAGGTGG + Intronic
1146790431 17:35747768-35747790 TGGGAGGCTGGAGGCAGAGGTGG - Intronic
1147145493 17:38482284-38482306 TGGGAGGCCCGGGGCAGGCGGGG - Intronic
1147716113 17:42509819-42509841 TGGGTGGCCAGAGACTGGGGAGG - Intronic
1147742278 17:42676156-42676178 TGGGGGCCCTGAGGCAGGGGAGG - Intronic
1147935225 17:44007032-44007054 TGGGTGGGCCGGGTCAGCGGCGG + Intronic
1147951764 17:44111437-44111459 TGGGTGGCCAGAGGCTGGGCTGG + Intronic
1148607849 17:48943892-48943914 TGGGGGGCCCCAGGCAGGGAGGG - Intronic
1150227859 17:63533564-63533586 TGGGTGGAGCCAGGCAGGGGAGG - Intronic
1150337198 17:64339125-64339147 TGGAGGCCTCGAGGCAGAGGTGG + Intronic
1150422964 17:65055842-65055864 TGGGTGACCCGAGTCACATGGGG - Intronic
1150654658 17:67031869-67031891 TGGGGGTCCCGGGGGAGAGGTGG + Exonic
1151727677 17:75894148-75894170 TGGGAGGACTGAGACAGAGGTGG - Intronic
1152231709 17:79117220-79117242 TGGGCTGCTCCAGGCAGAGGCGG - Intronic
1152291909 17:79444554-79444576 TGGGTGCCCAGAGGAAGTGGTGG - Intronic
1152559722 17:81071986-81072008 GGGGAGGCCGGAAGCAGAGGGGG - Intronic
1152576460 17:81143435-81143457 TGCATGGCCCCAGGCAGAGCTGG - Intronic
1152750465 17:82060221-82060243 TGGGCTGCCCGAGGGAAAGGAGG - Intronic
1152892533 17:82890685-82890707 TTGCTGGCCCGAGGCAGCCGAGG + Intronic
1153341455 18:3978844-3978866 TTGATGGACAGAGGCAGAGGAGG + Intronic
1153781483 18:8498962-8498984 TGGGTGGGCTGAGGAGGAGGAGG + Intergenic
1154492342 18:14931921-14931943 TGGGGGGCCCGGGACAGAGCAGG - Intergenic
1157506385 18:48229742-48229764 AGGGAGGCCCGAGGAAGACGTGG + Intronic
1157606437 18:48928858-48928880 AGGGTGGCACGGGGCAGGGGAGG + Intronic
1158592257 18:58787875-58787897 TGGGTGGCCCAAAGGAGAAGGGG - Intergenic
1158765569 18:60446848-60446870 TGGCTGCCCCTTGGCAGAGGAGG + Intergenic
1161028280 19:2046580-2046602 TGAGGGGCCCGAGGGGGAGGAGG - Intronic
1161124955 19:2550689-2550711 GGGCTGGCCAGAGGCAGAGCGGG - Intronic
1161168999 19:2803834-2803856 TGGGGGGCCAGAGGCAGATGGGG - Intronic
1161615572 19:5268445-5268467 TGGGTGGCCGTGGACAGAGGTGG + Intronic
1162739616 19:12766442-12766464 TGGGTGGGGCTAGGCAGGGGCGG + Intronic
1163727776 19:18932368-18932390 TGGGTGGCGCTGGGCTGAGGCGG + Intronic
1163815756 19:19463526-19463548 AGGGTGGCCGGGGGCAGCGGAGG + Intronic
1164210891 19:23096461-23096483 TGGGAGGGCCCAGGCAGAAGAGG - Intronic
1164399974 19:27895734-27895756 TGGGTGGCCCCAAGCAGACAAGG - Intergenic
1164617919 19:29677665-29677687 TGGGTGGCTGGTGGGAGAGGGGG + Intergenic
1164866648 19:31609982-31610004 GGGGTGTCCACAGGCAGAGGTGG + Intergenic
1165243985 19:34487461-34487483 TGGGAGGCCCTGGGCAGAGCAGG + Intronic
1166060230 19:40321299-40321321 TGGGAGGCCGGAGGTACAGGAGG + Exonic
1167075130 19:47243947-47243969 TGGGGAGACTGAGGCAGAGGAGG - Intergenic
1167375582 19:49109236-49109258 TGGGAGGCCAGAGGGAGAGCGGG + Intergenic
1167583014 19:50357652-50357674 TGGGTAGCAAGAGGCTGAGGAGG + Intronic
1167606029 19:50481603-50481625 TGTGTGGCCCGAGGCAGGCTAGG + Intronic
1167649078 19:50719718-50719740 GCGGCGGCCCGAGGAAGAGGAGG - Intergenic
925160796 2:1681952-1681974 TGAGGGGCCCCAGGCGGAGGAGG - Intronic
925370353 2:3340342-3340364 CGGCTTGCCCGAGGCAGAGCAGG + Intronic
926130752 2:10302295-10302317 TGGGGAAACCGAGGCAGAGGCGG + Intergenic
926173814 2:10571270-10571292 TGCGTGGCTAGAGCCAGAGGAGG - Intronic
927516552 2:23675016-23675038 GGAGTGGCCAGAGCCAGAGGTGG - Intronic
927868802 2:26610361-26610383 TGGGTGGGCAGGGGGAGAGGCGG - Intronic
928108467 2:28488255-28488277 GTGGTGCCCAGAGGCAGAGGTGG + Intronic
929778002 2:44940485-44940507 GTGGTGGCCAGAGGCAGAGAGGG + Intergenic
930872828 2:56184943-56184965 GGGGTGCCCCGAGGAGGAGGCGG + Intronic
931246099 2:60493954-60493976 TGAGTGGCCTCAGGCAGTGGCGG + Intronic
932082320 2:68726251-68726273 TGAGTGGCAGGAGGCAGAGTGGG + Intronic
932799849 2:74731446-74731468 TGGCTGGACCGAGGGAGAGAGGG + Intergenic
933834280 2:86232707-86232729 TGGGGGGCCCGAGGGAGCAGGGG + Exonic
934514557 2:94977974-94977996 TGGGTGGCCACAGGCAGTGTGGG - Intergenic
935005106 2:99066823-99066845 TGGGTGGCCAGAGGGAGCTGTGG - Intronic
935559487 2:104545429-104545451 TATGTGGCCCAAGGCAGAGAAGG + Intergenic
936059557 2:109285547-109285569 TGGGAGCCCAGAGGCTGAGGTGG + Intronic
936450146 2:112627694-112627716 GCGGTGGCCCAAGGCAGTGGAGG - Intergenic
937252229 2:120532242-120532264 TGAGTGACCCAAGGGAGAGGGGG - Intergenic
938079811 2:128363899-128363921 TGGGTGGCCAGCCGAAGAGGAGG - Intergenic
942135320 2:172919482-172919504 TGAGTGGCCAGAGAGAGAGGAGG - Intronic
942346244 2:175005405-175005427 CGGGAAGCCCGAGGGAGAGGCGG - Intergenic
942445286 2:176073266-176073288 TGACTGCCCCGAGGCTGAGGAGG - Intergenic
944114468 2:196171751-196171773 TGGCTGGCCCGAGGCGGGGCGGG + Intronic
945232383 2:207606231-207606253 TTGGGAGGCCGAGGCAGAGGAGG + Intronic
945735844 2:213599436-213599458 TGAGTAGGCCGAGGAAGAGGAGG - Intronic
946173193 2:217907394-217907416 TGGCTGGCCCCAAGCACAGGAGG + Intronic
946280835 2:218664399-218664421 TGGGTCGCCACAGGCAGAGGAGG + Exonic
946295728 2:218782193-218782215 TGGGCTGCGCGAGGCTGAGGTGG + Exonic
946358922 2:219207163-219207185 GGGGTGGTCAGCGGCAGAGGGGG + Intronic
947035613 2:225851071-225851093 TGAGTGGTCTGAGGAAGAGGAGG + Intergenic
947666767 2:231910900-231910922 TGGGTGGGGAGGGGCAGAGGCGG - Intergenic
948136401 2:235639423-235639445 AGGGTGGGCAGAGGAAGAGGAGG + Intronic
948142628 2:235685074-235685096 TGGGTGGGCCGAGGTTGAGTGGG + Intronic
948463318 2:238140525-238140547 GGGGTGGCTTGAGGCAGATGGGG + Intronic
948613015 2:239181396-239181418 TGGGTGGGCCGAGGGAGAGGGGG + Intronic
948659780 2:239499808-239499830 TGGAAGGCACGAGGCAGCGGAGG + Intergenic
948685416 2:239666749-239666771 TGGGAGGCAGGAGGCAGAGCAGG - Intergenic
948888014 2:240893464-240893486 TGCGTGGCCCACGGCAGATGAGG - Intronic
949035227 2:241813101-241813123 CCGGTGGCCCAGGGCAGAGGTGG + Intronic
1168844998 20:938337-938359 TGTGTGGATCGAGCCAGAGGTGG - Intergenic
1170103408 20:12727196-12727218 TGGGTGGAGGGAGGCAGGGGAGG - Intergenic
1170674979 20:18470724-18470746 TGGGTGGGTGGTGGCAGAGGTGG - Intronic
1171289720 20:23975366-23975388 AGGGTGGTCCCAGGCAGGGGTGG + Intergenic
1171815678 20:29784019-29784041 TGGCTGGCACGATGGAGAGGAGG - Intergenic
1172133465 20:32671880-32671902 TGGGTTGCCAGGGGCTGAGGGGG + Intergenic
1172774056 20:37397117-37397139 AGGGTGGCACCAGGCGGAGGTGG - Intronic
1172889268 20:38252580-38252602 TGGTGGTCCCCAGGCAGAGGGGG - Intronic
1173252292 20:41370350-41370372 AGGGAGGCCAGAAGCAGAGGAGG + Intergenic
1173916971 20:46714917-46714939 TGGGGTGCAGGAGGCAGAGGTGG - Intronic
1175483437 20:59327533-59327555 ACGGAGGCCCCAGGCAGAGGAGG + Intergenic
1175591882 20:60200105-60200127 TGGCTGCCCCTTGGCAGAGGAGG + Intergenic
1175990296 20:62785340-62785362 AGGGTGGGGTGAGGCAGAGGTGG + Intergenic
1176051986 20:63124735-63124757 TGGGGGGCAGGAGGCAGAGGAGG + Intergenic
1176115329 20:63429572-63429594 TGGGTGGGCAGAGGCAGGGCAGG - Intronic
1176386510 21:6140790-6140812 TGCGTGGCCCGAGGAAGCTGAGG + Intergenic
1179141543 21:38730212-38730234 TGGGTGGCCAGGGGCTGGGGTGG - Intergenic
1179161325 21:38901958-38901980 TGAGTGGGCTGAGGAAGAGGAGG + Intergenic
1179411540 21:41167371-41167393 AGGGTGGAAGGAGGCAGAGGAGG - Intergenic
1179736963 21:43397462-43397484 TGCGTGGCCCGAGGAAGCTGAGG - Intergenic
1179885456 21:44312390-44312412 TGGGTGCCCCGAGGCAGAGGAGG + Intronic
1180945253 22:19689012-19689034 AGGGTGGCAGGAGGGAGAGGAGG - Intergenic
1181462077 22:23091863-23091885 TGGCTGGACTGAGGGAGAGGAGG - Intronic
1181508611 22:23378741-23378763 AGGGTGGTCCCAGGCAGAGCAGG - Intergenic
1181528157 22:23501877-23501899 CGGGTGGCGGGTGGCAGAGGTGG - Intergenic
1181977684 22:26742606-26742628 TTGGGGGGCCGAGGCAGGGGCGG + Intergenic
1182451863 22:30426527-30426549 TCAGTGGCCCGAGTCCGAGGTGG + Intronic
1182501015 22:30747667-30747689 TGGGTGGGGCAAGGAAGAGGAGG - Intronic
1183279500 22:36924384-36924406 TGGGTGGCACAGGGCAGAGTGGG - Intronic
1183359516 22:37376163-37376185 TGGGTGGCAAGAGGCAGGAGGGG + Intronic
1183398816 22:37589031-37589053 TGTGTGGCCCAGGGCAGAGCTGG - Intergenic
1183432472 22:37774176-37774198 AGGGTGGCTGGAGACAGAGGGGG - Exonic
1184562100 22:45269249-45269271 TGGGTAGGCGGAGGCGGAGGCGG + Intergenic
1184578263 22:45392642-45392664 TGGGTGGCCAGAGACATAGGAGG + Intronic
1184690971 22:46117096-46117118 CAGGTGGCCCCAGGCAGAAGAGG + Intergenic
1184803665 22:46777629-46777651 AGGCTGGCAGGAGGCAGAGGAGG + Intronic
1184878859 22:47292320-47292342 TGGGTGCCAGGATGCAGAGGTGG + Intergenic
1185241751 22:49750650-49750672 TGGGGGGCCTGAGACAGGGGTGG - Intergenic
1185417228 22:50716820-50716842 TGGGTGGACAGATGCACAGGTGG - Intergenic
950263155 3:11556315-11556337 AGGGGGGCCTGGGGCAGAGGAGG - Exonic
950540408 3:13609117-13609139 TGGGCTGCCTGGGGCAGAGGTGG - Intronic
950962220 3:17118893-17118915 TGGGTGGCCCCAGCCTCAGGGGG + Intergenic
951564813 3:24002750-24002772 TAGTTGGCCCCAGGCAGAGCGGG - Intergenic
951709548 3:25574562-25574584 TGGGAGGCCGGGAGCAGAGGCGG - Intronic
951851217 3:27142335-27142357 TGGGTGAAAAGAGGCAGAGGTGG - Intronic
951950008 3:28189618-28189640 TGAGTAGGCTGAGGCAGAGGAGG - Intergenic
952764844 3:36944922-36944944 GGGGCGGCGCGATGCAGAGGCGG + Exonic
953457616 3:43055399-43055421 AGGGTGGACAGAGACAGAGGTGG - Intronic
953603181 3:44387662-44387684 TGGCTGGCCCTTGGCAGATGTGG + Intronic
954329924 3:49884441-49884463 TGGGTGGCCAGTGCAAGAGGAGG - Intergenic
954529199 3:51303927-51303949 TGGCTGCCCCTTGGCAGAGGGGG + Intronic
954802248 3:53194013-53194035 AGGCTGGCCCAAGGCAGAGCAGG - Intergenic
956592103 3:70925805-70925827 TGGGTGTCCAGATGCAGAGAGGG + Intergenic
960682425 3:120263193-120263215 TGGGTGGCCCTTGGCAGGTGTGG + Intronic
961680200 3:128594773-128594795 TGGTTGGCCCGATGCTGAGCAGG - Intergenic
961779397 3:129312938-129312960 TGGGTGACAAGAGGCAGGGGTGG + Intergenic
961817552 3:129559015-129559037 TGGGTGGCCTGAGGTGGGGGTGG - Intronic
966429944 3:179820805-179820827 TGGGTGGCCCAAGGGGCAGGAGG + Intronic
967257591 3:187609415-187609437 AGGGTGGCCAGAGGCATGGGGGG - Intergenic
968031966 3:195507745-195507767 TGGGAGGCCGGAGGCCGAGGTGG + Intergenic
968576877 4:1370784-1370806 TCAGTGGCCCAAGTCAGAGGTGG + Intronic
968682142 4:1928729-1928751 TGGGGTGCCAGGGGCAGAGGTGG + Intronic
968909715 4:3471467-3471489 AGGGTCCCCCAAGGCAGAGGTGG + Intronic
968942721 4:3647151-3647173 TGGGTGGCATGTGGCAGAGGGGG - Intergenic
969585108 4:8087156-8087178 GGGGTGTCCCCAGACAGAGGAGG - Intronic
970567408 4:17346159-17346181 TGGGTGGCTGGGGACAGAGGTGG - Intergenic
974913197 4:68148379-68148401 TGGCTGCCCCTTGGCAGAGGGGG + Intergenic
976214567 4:82704222-82704244 TGGAAGGCCCATGGCAGAGGTGG + Intronic
978919184 4:114161985-114162007 TGGCTGTCCCCAGGCAGAGAGGG + Intergenic
981903535 4:149893597-149893619 TGGGTGGGCAGAGAAAGAGGAGG - Intergenic
982372337 4:154647492-154647514 TGGCTGCCCCTTGGCAGAGGGGG - Intronic
983978180 4:173962659-173962681 GGGGTGGCAAGAGGCAGAAGAGG - Intergenic
984192405 4:176621476-176621498 TGGGAGGCAAGAGGCTGAGGTGG - Intergenic
984599556 4:181710607-181710629 CGGGAGGCCAGAGGCTGAGGCGG + Intergenic
985765641 5:1778054-1778076 TGGGTGACCAGAGGCCCAGGGGG - Intergenic
985770612 5:1807897-1807919 TGGGGGGCAGGAGGAAGAGGTGG + Intronic
985879166 5:2625489-2625511 AGGGCTGCCTGAGGCAGAGGAGG + Intergenic
986070415 5:4277719-4277741 TGGGTGGGCAGAGGCTGGGGAGG - Intergenic
988360126 5:30226654-30226676 TGTGTGGGCCAAGGTAGAGGTGG - Intergenic
988362794 5:30256843-30256865 TGAGTGGCCTGAGGAAGAGGAGG + Intergenic
988977458 5:36529104-36529126 AGGCTGGCCTGAGGCAGAGCTGG - Intergenic
992863660 5:80937118-80937140 TGGCTGGACCCAGGCAGAGCTGG - Intergenic
994078325 5:95678585-95678607 TGGGTGGCGCGGGGGAGGGGAGG + Intronic
995634053 5:114165236-114165258 TGGGGTGACAGAGGCAGAGGAGG - Intergenic
996355493 5:122591880-122591902 TGGGAGGCACGGGGAAGAGGTGG - Intergenic
999192617 5:149759805-149759827 TGGGTGGCCCCTGGCCCAGGGGG - Intronic
999644887 5:153707825-153707847 TGGGGGGCGCGTGGGAGAGGAGG + Intronic
1002105408 5:176877367-176877389 TGCCTGGCCCGAGGCGGCGGGGG + Intronic
1002175477 5:177399063-177399085 GGGGTGGCCCCAGGCCTAGGAGG - Intergenic
1002260773 5:177992723-177992745 TGGATGGCTCAAGGCTGAGGGGG + Exonic
1002368308 5:178730192-178730214 TGGGTGTCCCGAGGCGGGAGGGG + Intronic
1002448297 5:179303342-179303364 TGGGTGGCTGCAGGCAGTGGGGG - Intronic
1002549995 5:179980992-179981014 GGGGTGGGGCGAGGCAGGGGAGG + Intronic
1003021338 6:2512269-2512291 TGGGTGGAGGGAGACAGAGGAGG - Intergenic
1003054723 6:2807814-2807836 GAGGTGGCACGAGGCTGAGGAGG - Intergenic
1004696967 6:18042884-18042906 TGGGTGGCTCAGGGCAGCGGAGG - Intergenic
1006367085 6:33622005-33622027 TGGGTGGCTGGAGGCTGAGTTGG + Intronic
1006779577 6:36623195-36623217 TGGGTGGTCAGTGTCAGAGGCGG + Intergenic
1007135923 6:39521956-39521978 TGGGTGGGATGAGACAGAGGTGG - Intronic
1007220931 6:40278182-40278204 TGGGTGGAGGGAGGAAGAGGTGG + Intergenic
1007381782 6:41494922-41494944 TGGGCGGGGGGAGGCAGAGGGGG + Intergenic
1007806516 6:44454010-44454032 TGAGTGGGCCGAGGAGGAGGTGG - Intergenic
1010203925 6:73306670-73306692 TTGGTGCCCCGGGGCAGTGGGGG + Intronic
1011046223 6:83086396-83086418 TGAGTGGGCAGAGGAAGAGGAGG + Intronic
1012201859 6:96416383-96416405 TGGGAGGCTTAAGGCAGAGGTGG + Intergenic
1013667960 6:112367120-112367142 CAGGTGGCCGGCGGCAGAGGCGG + Intergenic
1013895022 6:115077462-115077484 TGGGTGGGCAAAGGCAGAAGTGG + Intergenic
1014297187 6:119633720-119633742 TGAGTAGCCTGAGGAAGAGGGGG - Intergenic
1014764718 6:125393191-125393213 TGGGTGGCCTTGGGTAGAGGTGG + Intergenic
1015255500 6:131175191-131175213 TGAGTGGACTGAGGAAGAGGAGG + Intronic
1018721774 6:166578329-166578351 TGGGTGGCCCTAGGAAGTAGTGG + Intronic
1018910775 6:168100069-168100091 TGGTTGGCCGGGGGCACAGGGGG - Intergenic
1019365952 7:632892-632914 TGTGTGGCCCCAGGCTCAGGAGG - Intronic
1019367825 7:644404-644426 TGGGTGTGCAGAGGCTGAGGGGG + Intronic
1019586758 7:1809234-1809256 TGGGTGGCCCCAGGAAGGGGCGG + Intergenic
1020274724 7:6617085-6617107 TGGGTGGCCCGAGGCAGAGGTGG + Intronic
1022333341 7:29400278-29400300 TGACTGGAACGAGGCAGAGGTGG - Intronic
1022529490 7:31057998-31058020 TGTGTGGCCCAAAGAAGAGGTGG + Intronic
1022777777 7:33545290-33545312 AGGGTGGCCAGAGGAACAGGGGG - Intronic
1023314114 7:38917549-38917571 TGGTTGGCCAGAAGCACAGGAGG + Intronic
1025702921 7:63836393-63836415 TGAGTGTCCCAAGGGAGAGGAGG + Intergenic
1025941008 7:66076152-66076174 AGGGTGGCCCGAGGCAGGTCTGG - Intronic
1026107538 7:67433054-67433076 TGTGGGGCCCCAGACAGAGGAGG - Intergenic
1026731477 7:72915444-72915466 TGGGAGGTGCGAGGCGGAGGAGG - Intronic
1027112563 7:75452384-75452406 TGGGAGGTGGGAGGCAGAGGAGG + Intronic
1029269733 7:99369914-99369936 TGGGTGGGCCAAGGCAGACCAGG - Intronic
1029490111 7:100866287-100866309 TGGGGAACCCGAGGCGGAGGAGG + Exonic
1029514943 7:101018390-101018412 GGGGTGGCCCCAGGGTGAGGAGG - Intronic
1030059591 7:105612243-105612265 TGGGTGAACCAAGGCACAGGAGG - Intronic
1034509013 7:151519520-151519542 TGGTTGGGCCGGGGCTGAGGAGG - Exonic
1034964179 7:155381627-155381649 TGCGCGGCCCCAGGGAGAGGGGG + Intergenic
1035100022 7:156388984-156389006 TAGGAGGCTCAAGGCAGAGGAGG - Intergenic
1035287070 7:157813382-157813404 TGGGAGACCAGAGTCAGAGGCGG + Intronic
1035473801 7:159128462-159128484 TGGGAGGCCCAAGGCAGGAGGGG - Intronic
1035542506 8:452866-452888 TGGGTGGGCCGAGACAGAGCAGG + Intronic
1035781843 8:2233779-2233801 AGGGTGCCCCGAGGCAGATGTGG + Intergenic
1036701903 8:11018495-11018517 TGGGGGTCCCCAGGGAGAGGAGG + Intronic
1036914910 8:12796200-12796222 GCGGTGGGCCCAGGCAGAGGAGG - Intergenic
1038180714 8:25224813-25224835 AGGGTGGCCCAGAGCAGAGGTGG - Intronic
1038416641 8:27401291-27401313 TGAGGAGCCCAAGGCAGAGGGGG + Intronic
1038496737 8:28008605-28008627 AGGGAGGCCCAGGGCAGAGGTGG - Intergenic
1039567232 8:38560174-38560196 TAGGTGGGTGGAGGCAGAGGTGG + Intergenic
1039883552 8:41642399-41642421 GGGGTGGCCCGAGGATGAGGAGG + Intergenic
1039981285 8:42411506-42411528 TGGGTGGCCCGGAGGAGACGGGG + Intergenic
1040014474 8:42689727-42689749 TGGGTGGGGGGAGGCAGGGGAGG - Intergenic
1042078645 8:65024569-65024591 CAGGTGGCCCCAGACAGAGGTGG + Intergenic
1043453091 8:80387913-80387935 AGGGTGGCCAGGCGCAGAGGAGG + Intergenic
1044564991 8:93653140-93653162 TGGGGGGCCTGAGACAGAGCTGG - Intergenic
1044706043 8:95009625-95009647 GGGCTGGCCCGAAGCAGATGGGG - Intronic
1045474862 8:102544204-102544226 TGGATGGCCCGAGGAGGAGGAGG - Intergenic
1046964979 8:120153979-120154001 TGGTTGGCCCTATGCAGTGGGGG + Intronic
1047522599 8:125606628-125606650 TGACTGGCCCCAGGCATAGGAGG + Intergenic
1047757338 8:127928694-127928716 AGGGAGGCCAGAGACAGAGGAGG - Intergenic
1049298078 8:141854529-141854551 GGGGTGTACAGAGGCAGAGGTGG + Intergenic
1049374830 8:142284382-142284404 CAGGTGGCCCGAGGCTGGGGCGG + Intronic
1049427566 8:142544193-142544215 TGGGTGGCCCGTGGTGCAGGAGG - Intronic
1049510930 8:143026329-143026351 TGGGAGGCCCCAGGCAGAGAAGG - Intergenic
1049585593 8:143431095-143431117 CGCGTGGCCCGAGGCGGACGAGG - Intergenic
1049746411 8:144265115-144265137 TGGGCGGCCCGAAGCGGGGGTGG - Intronic
1050344039 9:4668648-4668670 TTGTTGGCCCCCGGCAGAGGTGG - Intergenic
1050507783 9:6365273-6365295 TGGGTGGCAGGAGGCTGTGGGGG + Intergenic
1050600102 9:7241942-7241964 AGGGGTGCCAGAGGCAGAGGAGG - Intergenic
1051265760 9:15307129-15307151 TGGGTGGCAGCAGCCAGAGGAGG - Exonic
1055295250 9:74827078-74827100 GGGGTGGCCCTAGGCAGGGAAGG - Intronic
1056709213 9:88977095-88977117 TGGGTGTGACAAGGCAGAGGTGG + Intergenic
1057442514 9:95092306-95092328 TGGGTGGGCCCAGGCGGGGGTGG - Intergenic
1057484120 9:95468822-95468844 AGGGGGGCTCGAGGCAGTGGAGG + Exonic
1057590428 9:96368551-96368573 TGGGTGGCAGGAAGCTGAGGTGG - Intronic
1059341804 9:113601487-113601509 TGGGTGGGAGGAGGCAGTGGGGG + Intergenic
1059457074 9:114406455-114406477 TGGGTGGCCAGAGGGTGATGGGG + Exonic
1059754725 9:117281892-117281914 GGGGTGATCCGAGGCTGAGGAGG - Intronic
1060804146 9:126564223-126564245 TGGGAGGCCGGAGACAGATGAGG + Intergenic
1061221168 9:129253178-129253200 AGGGTGACCTGGGGCAGAGGTGG - Intergenic
1061676912 9:132222682-132222704 TGGGTGGGCCGTGGGAGAGGGGG - Intronic
1061894502 9:133640135-133640157 AGGATGGCCAGAGGCAGTGGTGG + Intronic
1061951837 9:133940568-133940590 GGAGTGGCCTGAGGCAGAAGGGG - Intronic
1062044901 9:134420459-134420481 TTGGGGGCCCGAGCCAGAAGGGG - Intronic
1062199606 9:135295047-135295069 TGGGTGGCCTCAGGCACAGGTGG + Intergenic
1062254685 9:135615332-135615354 GGTGTGGGCCGGGGCAGAGGAGG - Intergenic
1062265011 9:135683041-135683063 TGGGAGGCCTGAGGCAGGGGCGG + Intergenic
1062596627 9:137302575-137302597 CGGGTGGCCGGAGGGAGAAGGGG - Intergenic
1062628347 9:137452967-137452989 TGCGTGGTCCCAGGCAGAGCTGG + Intronic
1062656121 9:137605357-137605379 TGGGGCGGCCGAGGCAGGGGCGG + Intergenic
1203792680 EBV:160146-160168 GGGGCGGCCGGAGGCAGAGGGGG - Intergenic
1186025134 X:5302079-5302101 TGAGTGGGCCGAAGAAGAGGAGG - Intergenic
1186740956 X:12517718-12517740 TGGCTGCCCCTTGGCAGAGGGGG + Intronic
1187748313 X:22433248-22433270 AGGGTGGCCAGAGGAACAGGGGG + Intergenic
1187961576 X:24571114-24571136 TGGGTGGCGGGAGGCCAAGGTGG + Intronic
1189007355 X:37009682-37009704 TGGGAGGCTCCAGGCAGAGATGG - Exonic
1189041061 X:37542665-37542687 TGGGAGGCTCCAGGCAGAGATGG + Intronic
1189689237 X:43598772-43598794 TGGTTGTTCAGAGGCAGAGGTGG - Intergenic
1191880301 X:65838673-65838695 GGGGTAGCCTGAGGCACAGGTGG - Intergenic
1192215168 X:69153118-69153140 TGGGTAGTGTGAGGCAGAGGTGG - Intergenic
1192799291 X:74450523-74450545 TGGGTGGGGCGGGGCAGAGCAGG - Intronic
1199694030 X:150330857-150330879 TGTGTGGCATGAAGCAGAGGAGG - Intergenic
1200074886 X:153546017-153546039 TGGGGGCCGCGTGGCAGAGGGGG - Intronic
1200219357 X:154383564-154383586 TGGCTGGACAGAGGCAGATGGGG + Intergenic
1201991047 Y:20026646-20026668 TCAGAGGCCCAAGGCAGAGGAGG + Intergenic
1202305871 Y:23469804-23469826 TTGGTGGACTGAGTCAGAGGAGG + Intergenic
1202564938 Y:26200785-26200807 TTGGTGGACTGAGTCAGAGGAGG - Intergenic