ID: 1020275252

View in Genome Browser
Species Human (GRCh38)
Location 7:6620483-6620505
Sequence CTGTGTAAAGGGAAGCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020275244_1020275252 3 Left 1020275244 7:6620457-6620479 CCAGTGCCGAGATCAGAGCATGG 0: 1
1: 0
2: 4
3: 30
4: 262
Right 1020275252 7:6620483-6620505 CTGTGTAAAGGGAAGCTCCAAGG No data
1020275243_1020275252 13 Left 1020275243 7:6620447-6620469 CCTGCTAGTGCCAGTGCCGAGAT 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1020275252 7:6620483-6620505 CTGTGTAAAGGGAAGCTCCAAGG No data
1020275238_1020275252 24 Left 1020275238 7:6620436-6620458 CCCCCAGCATCCCTGCTAGTGCC 0: 1
1: 0
2: 1
3: 28
4: 239
Right 1020275252 7:6620483-6620505 CTGTGTAAAGGGAAGCTCCAAGG No data
1020275240_1020275252 22 Left 1020275240 7:6620438-6620460 CCCAGCATCCCTGCTAGTGCCAG 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1020275252 7:6620483-6620505 CTGTGTAAAGGGAAGCTCCAAGG No data
1020275241_1020275252 21 Left 1020275241 7:6620439-6620461 CCAGCATCCCTGCTAGTGCCAGT 0: 1
1: 0
2: 0
3: 6
4: 182
Right 1020275252 7:6620483-6620505 CTGTGTAAAGGGAAGCTCCAAGG No data
1020275248_1020275252 -3 Left 1020275248 7:6620463-6620485 CCGAGATCAGAGCATGGGGCCTG 0: 1
1: 0
2: 1
3: 32
4: 232
Right 1020275252 7:6620483-6620505 CTGTGTAAAGGGAAGCTCCAAGG No data
1020275239_1020275252 23 Left 1020275239 7:6620437-6620459 CCCCAGCATCCCTGCTAGTGCCA 0: 1
1: 0
2: 0
3: 19
4: 222
Right 1020275252 7:6620483-6620505 CTGTGTAAAGGGAAGCTCCAAGG No data
1020275242_1020275252 14 Left 1020275242 7:6620446-6620468 CCCTGCTAGTGCCAGTGCCGAGA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1020275252 7:6620483-6620505 CTGTGTAAAGGGAAGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020275252 Original CRISPR CTGTGTAAAGGGAAGCTCCA AGG Intronic
No off target data available for this crispr