ID: 1020278062

View in Genome Browser
Species Human (GRCh38)
Location 7:6636840-6636862
Sequence TTGTGGGTGGGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020278062_1020278079 9 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278079 7:6636872-6636894 CCCGCGCGGGCCCGGGGATCTGG No data
1020278062_1020278076 3 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278076 7:6636866-6636888 GTTCACCCCGCGCGGGCCCGGGG No data
1020278062_1020278073 -4 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278073 7:6636859-6636881 ACAAGACGTTCACCCCGCGCGGG No data
1020278062_1020278082 15 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278082 7:6636878-6636900 CGGGCCCGGGGATCTGGTGGAGG No data
1020278062_1020278072 -5 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278062_1020278075 2 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278075 7:6636865-6636887 CGTTCACCCCGCGCGGGCCCGGG No data
1020278062_1020278086 28 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278062_1020278085 20 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278085 7:6636883-6636905 CCGGGGATCTGGTGGAGGCGTGG No data
1020278062_1020278074 1 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278074 7:6636864-6636886 ACGTTCACCCCGCGCGGGCCCGG No data
1020278062_1020278081 12 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278081 7:6636875-6636897 GCGCGGGCCCGGGGATCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020278062 Original CRISPR TTGTGGGTGGGGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr